e.g. 1:1246..9423
SNP Detail For snp_cf0029001232363    [See in GBrowse]
1.General Information
SNP ID: snp_cf0029001232363
Organism: Canis familiaris
Individual: GS5
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs22881901  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: CCCCGCGCTGTTCACCACGGCAACGCTCTC
3'flank: TTGCTGATGGAGAAGAGGATATTGGACTGG
3.Reference Map information
Chrom Position Reference GS5
Chr20 3662363 A G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000004375 78312 - A CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000050198 2763 AAT => AAC ENSCAFP00000041391 921 N => N
- ENSCAFT00000007053 3219 AAT => AAC ENSCAFP00000006530 1073 N => N
- ENSCAFT00000048997 3351 AAT => AAC ENSCAFP00000036016 1117 N => N
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0072001757692 YJ3 R CCCCGCGCTGTTCACCACGGCAACGCTCTC TTGCTGATGGAGAAGAGGATATTGGACTGG 2014-07-19 2014-07-19
snp_cf0041001727596 KM6 R CCCCGCGCTGTTCACCACGGCAACGCTCTC TTGCTGATGGAGAAGAGGATATTGGACTGG 2014-07-19 2014-07-19
snp_cf0052001669606 LJ7 R CCCCGCGCTGTTCACCACGGCAACGCTCTC TTGCTGATGGAGAAGAGGATATTGGACTGG 2014-07-19 2014-07-19
snp_cf0012001695898 DQ4 G CCCCGCGCTGTTCACCACGGCAACGCTCTC TTGCTGATGGAGAAGAGGATATTGGACTGG 2014-07-19 2014-07-19
snp_cf0023001605243 FAMICHN00003 R CCCCGCGCTGTTCACCACGGCAACGCTCTC TTGCTGATGGAGAAGAGGATATTGGACTGG 2014-07-19 2014-07-19
snp_cf0010001688619 DQ2 R CCCCGCGCTGTTCACCACGGCAACGCTCTC TTGCTGATGGAGAAGAGGATATTGGACTGG 2014-07-19 2014-07-19
snp_cf0068001668493 TM9 G CCCCGCGCTGTTCACCACGGCAACGCTCTC TTGCTGATGGAGAAGAGGATATTGGACTGG 2014-07-19 2014-07-19
snp_cf0055002138638 LUPWCHN00001 R CCCCGCGCTGTTCACCACGGCAACGCTCTC TTGCTGATGGAGAAGAGGATATTGGACTGG 2014-07-19 2014-07-19
snp_cf0061001736328 TM2 R CCCCGCGCTGTTCACCACGGCAACGCTCTC TTGCTGATGGAGAAGAGGATATTGGACTGG 2014-07-19 2014-07-19
snp_cf0008001707636 DQ10 R CCCCGCGCTGTTCACCACGGCAACGCTCTC TTGCTGATGGAGAAGAGGATATTGGACTGG 2014-07-19 2014-07-19
snp_cf0043001438600 KM8 G CCCCGCGCTGTTCACCACGGCAACGCTCTC TTGCTGATGGAGAAGAGGATATTGGACTGG 2014-07-19 2014-07-19
snp_cf0057002056128 LUPWRUS00002 G CCCCGCGCTGTTCACCACGGCAACGCTCTC TTGCTGATGGAGAAGAGGATATTGGACTGG 2014-07-19 2014-07-19
snp_cf0049001725489 LJ4 R CCCCGCGCTGTTCACCACGGCAACGCTCTC TTGCTGATGGAGAAGAGGATATTGGACTGG 2014-07-19 2014-07-19
snp_cf0015001708883 DQ7 R CCCCGCGCTGTTCACCACGGCAACGCTCTC TTGCTGATGGAGAAGAGGATATTGGACTGG 2014-07-19 2014-07-19
snp_cf0003000959060 dbSNP139 G CCCCGCGCTGTTCACCACGGCAACGCTCTC TTGCTGATGGAGAAGAGGATATTGGACTGG 2014-07-19 2014-07-19
snp_cf0040001519312 KM5 R CCCCGCGCTGTTCACCACGGCAACGCTCTC TTGCTGATGGAGAAGAGGATATTGGACTGG 2014-07-19 2014-07-19
snp_cf0071001745604 YJ2 R CCCCGCGCTGTTCACCACGGCAACGCTCTC TTGCTGATGGAGAAGAGGATATTGGACTGG 2014-07-19 2014-07-19
snp_cf0056002166334 LUPWRUS00001 G CCCCGCGCTGTTCACCACGGCAACGCTCTC TTGCTGATGGAGAAGAGGATATTGGACTGG 2014-07-19 2014-07-19
snp_cf0036001344662 KM1 R CCCCGCGCTGTTCACCACGGCAACGCTCTC TTGCTGATGGAGAAGAGGATATTGGACTGG 2014-07-19 2014-07-19
snp_cf0007001472408 Dingo G CCCCGCGCTGTTCACCACGGCAACGCTCTC TTGCTGATGGAGAAGAGGATATTGGACTGG 2014-07-19 2014-07-19
snp_cf0018001439781 FAMBBEM00001 G CCCCGCGCTGTTCACCACGGCAACGCTCTC TTGCTGATGGAGAAGAGGATATTGGACTGG 2014-07-19 2014-07-19
snp_cf0076001764100 YJ7 R CCCCGCGCTGTTCACCACGGCAACGCTCTC TTGCTGATGGAGAAGAGGATATTGGACTGG 2014-07-19 2014-07-19
snp_cf0005002034492 CHW G CCCCGCGCTGTTCACCACGGCAACGCTCTC TTGCTGATGGAGAAGAGGATATTGGACTGG 2014-07-19 2014-07-19
snp_cf0035001659943 KM10 R CCCCGCGCTGTTCACCACGGCAACGCTCTC TTGCTGATGGAGAAGAGGATATTGGACTGG 2014-07-19 2014-07-19
snp_cf0006001980169 CRW G CCCCGCGCTGTTCACCACGGCAACGCTCTC TTGCTGATGGAGAAGAGGATATTGGACTGG 2014-07-19 2014-07-19
snp_cf0024001363167 GS10 R CCCCGCGCTGTTCACCACGGCAACGCTCTC TTGCTGATGGAGAAGAGGATATTGGACTGG 2014-07-19 2014-07-19
snp_cf0059001704069 TM10 R CCCCGCGCTGTTCACCACGGCAACGCTCTC TTGCTGATGGAGAAGAGGATATTGGACTGG 2014-07-19 2014-07-19
snp_cf0075001751471 YJ6 G CCCCGCGCTGTTCACCACGGCAACGCTCTC TTGCTGATGGAGAAGAGGATATTGGACTGG 2014-07-19 2014-07-19
snp_cf0001000764446 solidGW1 R CCCCGCGCTGTTCACCACGGCAACGCTCTC TTGCTGATGGAGAAGAGGATATTGGACTGG 2014-08-01 2014-08-01
snp_cf0033001346308 GS9 R CCCCGCGCTGTTCACCACGGCAACGCTCTC TTGCTGATGGAGAAGAGGATATTGGACTGG 2014-07-19 2014-07-19
snp_cf0048001621570 LJ3 R CCCCGCGCTGTTCACCACGGCAACGCTCTC TTGCTGATGGAGAAGAGGATATTGGACTGG 2014-07-19 2014-07-19
snp_cf0011001735925 DQ3 R CCCCGCGCTGTTCACCACGGCAACGCTCTC TTGCTGATGGAGAAGAGGATATTGGACTGG 2014-07-19 2014-07-19
snp_cf0044001510323 KM9 R CCCCGCGCTGTTCACCACGGCAACGCTCTC TTGCTGATGGAGAAGAGGATATTGGACTGG 2014-07-19 2014-07-19
snp_cf0014001682025 DQ6 G CCCCGCGCTGTTCACCACGGCAACGCTCTC TTGCTGATGGAGAAGAGGATATTGGACTGG 2014-07-19 2014-07-19
snp_cf0062001715382 TM3 G CCCCGCGCTGTTCACCACGGCAACGCTCTC TTGCTGATGGAGAAGAGGATATTGGACTGG 2014-07-19 2014-07-19
snp_cf0004001437791 Basenji G CCCCGCGCTGTTCACCACGGCAACGCTCTC TTGCTGATGGAGAAGAGGATATTGGACTGG 2014-07-19 2014-07-19
snp_cf0078001749207 YJ9 R CCCCGCGCTGTTCACCACGGCAACGCTCTC TTGCTGATGGAGAAGAGGATATTGGACTGG 2014-07-19 2014-07-19
snp_cf0058002143934 LUPWRUS00003 G CCCCGCGCTGTTCACCACGGCAACGCTCTC TTGCTGATGGAGAAGAGGATATTGGACTGG 2014-07-19 2014-07-19
snp_cf0028001277351 GS4 R CCCCGCGCTGTTCACCACGGCAACGCTCTC TTGCTGATGGAGAAGAGGATATTGGACTGG 2014-07-19 2014-07-19
snp_cf0038001353089 KM3 G CCCCGCGCTGTTCACCACGGCAACGCTCTC TTGCTGATGGAGAAGAGGATATTGGACTGG 2014-07-19 2014-07-19
snp_cf0009001712069 DQ1 G CCCCGCGCTGTTCACCACGGCAACGCTCTC TTGCTGATGGAGAAGAGGATATTGGACTGG 2014-07-19 2014-07-19
snp_cf0032001312968 GS8 G CCCCGCGCTGTTCACCACGGCAACGCTCTC TTGCTGATGGAGAAGAGGATATTGGACTGG 2014-07-19 2014-07-19
snp_cf0037001447193 KM2 R CCCCGCGCTGTTCACCACGGCAACGCTCTC TTGCTGATGGAGAAGAGGATATTGGACTGG 2014-07-19 2014-07-19
snp_cf0064001721444 TM5 G CCCCGCGCTGTTCACCACGGCAACGCTCTC TTGCTGATGGAGAAGAGGATATTGGACTGG 2014-07-19 2014-07-19
snp_cf0042001789107 KM7 R CCCCGCGCTGTTCACCACGGCAACGCTCTC TTGCTGATGGAGAAGAGGATATTGGACTGG 2014-07-19 2014-07-19
snp_cf0039001413056 KM4 R CCCCGCGCTGTTCACCACGGCAACGCTCTC TTGCTGATGGAGAAGAGGATATTGGACTGG 2014-07-19 2014-07-19
snp_cf0047001657828 LJ2 R CCCCGCGCTGTTCACCACGGCAACGCTCTC TTGCTGATGGAGAAGAGGATATTGGACTGG 2014-07-19 2014-07-19
snp_cf0046001583950 LJ1 R CCCCGCGCTGTTCACCACGGCAACGCTCTC TTGCTGATGGAGAAGAGGATATTGGACTGG 2014-07-19 2014-07-19
snp_cf0073001705867 YJ4 G CCCCGCGCTGTTCACCACGGCAACGCTCTC TTGCTGATGGAGAAGAGGATATTGGACTGG 2014-07-19 2014-07-19
snp_cf0065001692761 TM6 G CCCCGCGCTGTTCACCACGGCAACGCTCTC TTGCTGATGGAGAAGAGGATATTGGACTGG 2014-07-19 2014-07-19
snp_cf0034002015801 ISW G CCCCGCGCTGTTCACCACGGCAACGCTCTC TTGCTGATGGAGAAGAGGATATTGGACTGG 2014-07-19 2014-07-19
6.Fasta Information
ACAGCCAGGC CCCGCACCAG CCCCGCGCTG TTCACCACGG CAACGCTCTC
G
TTGCTGATGG AGAAGAGGAT ATTGGACTGG GGCTGTGGGC CGCCCTCTGA