e.g. 1:1246..9423
SNP Detail For snp_cf0003001590907    [See in GBrowse]
1.General Information
SNP ID: snp_cf0003001590907
Organism: Canis familiaris
Individual: dbSNP139
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs24865422  
2.Allele Information
Platform: UNKNOWN
Method: sequence
SNP Class: snp
Genotype: C
5'flank: TTGTTTTGATGGCAGAAGTGGTGAGCCAGC
3'flank: CCTTGGCTGAAATTGCCTTGTGAACTCTTT
3.Reference Map information
Chrom Position Reference dbSNP139
Chr3 2477292 A C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000007417 227 - A CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000047226 144 GGT => GGG ENSCAFP00000036205 48 G => G
- ENSCAFT00000011885 177 GGT => GGG ENSCAFP00000011020 59 G => G
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
NA NA NA NA NA NA NA
6.Fasta Information
GGGTCCACTG CAAGGGACAA TTGTTTTGAT GGCAGAAGTG GTGAGCCAGC
C
CCTTGGCTGA AATTGCCTTG TGAACTCTTT GGACCATCCT CCACAGACTC