e.g. 1:1246..9423
SNP Detail For snp_cf0030003390447    [See in GBrowse]
1.General Information
SNP ID: snp_cf0030003390447
Organism: Canis familiaris
Individual: GS6
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs24501178  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: CTCCTGACAAGCAGAATGACCAGGCCGAGC
3'flank: GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA
3.Reference Map information
Chrom Position Reference GS6
Chr8 1968429 A G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000024864 5486 + A CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000038439 251 CAG => CGG ENSCAFP00000034158 84 Q => R
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0015004360320 DQ7 G CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0042004519484 KM7 R CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0024003430585 GS10 G CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0002002909919 CID1 R CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-08-02 2014-08-02
snp_cf0027003402672 GS3 G CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0061004421769 TM2 G CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0008004427970 DQ10 G CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0023004183050 FAMICHN00003 G CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0074004381517 YJ5 R CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0031003442218 GS7 R CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0043003678593 KM8 G CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0073004354927 YJ4 R CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0066004467547 TM7 R CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0009004358918 DQ1 G CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0054004009294 LJ9 R CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0019003391548 FAMBGSD00001 G CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0013004294399 DQ5 R CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0051004358047 LJ6 G CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0006005009318 CRW R CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0003002495629 dbSNP139 G CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0020004312431 FAMBTIM00001 G CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0012004352523 DQ4 G CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0039003688178 KM4 G CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0016004361893 DQ8 R CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0021004183596 FAMICHN00001 G CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0060004271132 TM1 R CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0063004283255 TM4 R CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0065004330553 TM6 R CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0032003359201 GS8 G CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0072004480940 YJ3 G CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0014004323225 DQ6 R CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0035004238791 KM10 R CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0064004397033 TM5 R CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0076004484955 YJ7 G CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0010004379696 DQ2 G CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0033003421241 GS9 G CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0017004408390 DQ9 G CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0036003479149 KM1 R CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0038003533112 KM3 G CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0078004446344 YJ9 G CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0022003871780 FAMICHN00002 G CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0047004242006 LJ2 R CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0077004441209 YJ8 G CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0040003766919 KM5 R CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0062004368177 TM3 G CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0070004609701 YJ1 G CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0071004451662 YJ2 G CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0029003211395 GS5 G CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0068004308604 TM9 R CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0011004421838 DQ3 G CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0026003425546 GS2 G CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0025003404062 GS1 G CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0069004487868 YJ10 R CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0007003700023 Dingo G CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0028003294417 GS4 G CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0059004352386 TM10 R CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0041004332109 KM6 R CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0046004077179 LJ1 R CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0048004156842 LJ3 R CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0037003629215 KM2 R CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0067004306665 TM8 G CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
snp_cf0053004263894 LJ8 G CTCCTGACAAGCAGAATGACCAGGCCGAGC GAAAGGTCAGTGCTGCCAGTCTAGCCAGAA 2014-07-19 2014-07-19
6.Fasta Information
TGAGGATGGA CTCGCAGAGG CTCCTGACAA GCAGAATGAC CAGGCCGAGC
G
GAAAGGTCAG TGCTGCCAGT CTAGCCAGAA GTGGGGGAGA GAGGATGTAG