e.g. 1:1246..9423
SNP Detail For snp_cf0030003390450    [See in GBrowse]
1.General Information
SNP ID: snp_cf0030003390450
Organism: Canis familiaris
Individual: GS6
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: A
5'flank: GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC
3'flank: AGGACTGGGAGGGTGCCAAGCGATGGAGGA
3.Reference Map information
Chrom Position Reference GS6
Chr8 1970832 C A
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000024864 7889 + C CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000038439 883 CAG => AAG ENSCAFP00000034158 295 Q => K
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0042004519487 KM7 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0023004183053 FAMICHN00003 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0008004427973 DQ10 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0027003402675 GS3 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0015004360323 DQ7 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0024003430588 GS10 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0041004332112 KM6 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0055005388267 LUPWCHN00001 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0040003766922 KM5 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0039003688181 KM4 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0034005043187 ISW A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0002002909922 CID1 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-08-02 2014-08-02
snp_cf0069004487872 YJ10 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0052004295438 LJ7 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0074004381521 YJ5 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0063004283257 TM4 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0057005166229 LUPWRUS00002 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0038003533115 KM3 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0077004441212 YJ8 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0021004183599 FAMICHN00001 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0043003678596 KM8 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0049004398699 LJ4 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0044003847088 KM9 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0012004352526 DQ4 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0019003391553 FAMBGSD00001 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0006005009320 CRW A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0016004361896 DQ8 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0060004271133 TM1 M GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0065004330557 TM6 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0020004312434 FAMBTIM00001 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0066004467551 TM7 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0009004358921 DQ1 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0010004379699 DQ2 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0036003479152 KM1 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0001001925284 solidGW1 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-08-01 2014-08-01
snp_cf0032003359204 GS8 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0013004294402 DQ5 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0064004397035 TM5 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0051004358050 LJ6 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0076004484958 YJ7 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0014004323228 DQ6 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0072004480943 YJ3 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0017004408393 DQ9 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0011004421842 DQ3 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0033003421244 GS9 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0075004460972 YJ6 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0056005412890 LUPWRUS00001 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0047004242009 LJ2 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0058005367345 LUPWRUS00003 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0078004446347 YJ9 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0028003294420 GS4 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0053004263898 LJ8 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0026003425549 GS2 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0070004609704 YJ1 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0073004354930 YJ4 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0046004077181 LJ1 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0068004308607 TM9 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0029003211398 GS5 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0007003700026 Dingo A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0004003645811 Basenji A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0035004238794 KM10 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0018003628594 FAMBBEM00001 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0059004352389 TM10 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0071004451665 YJ2 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0048004156846 LJ3 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0005005244055 CHW A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0037003629218 KM2 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0031003442221 GS7 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0062004368180 TM3 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0067004306668 TM8 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0025003404065 GS1 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
snp_cf0061004421772 TM2 A GAGCAGGAGCAGAAGGAGGAGCAGCTCTCC AGGACTGGGAGGGTGCCAAGCGATGGAGGA 2014-07-19 2014-07-19
6.Fasta Information
GCGGGAAGAA CAGGGAGCTG GAGCAGGAGC AGAAGGAGGA GCAGCTCTCC
A
AGGACTGGGA GGGTGCCAAG CGATGGAGGA TGGACCACCT GGCCANNNNN