e.g. 1:1246..9423
SNP Detail For snp_cf0030003390455    [See in GBrowse]
1.General Information
SNP ID: snp_cf0030003390455
Organism: Canis familiaris
Individual: GS6
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: AGGCCGACCTCCCGGGAGGACAGCGTGGAG
3'flank: CGAGTCTGCCCCTCCAGGTGCGCGGTTATG
3.Reference Map information
Chrom Position Reference GS6
Chr8 1971070 A G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000024864 8127 + A CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000038439 1121 GAC => GGC ENSCAFP00000034158 374 D => G
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0062004368185 TM3 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0023004183058 FAMICHN00003 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0049004398703 LJ4 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0040003766927 KM5 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0071004451670 YJ2 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0015004360328 DQ7 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0041004332117 KM6 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0069004487877 YJ10 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0025003404070 GS1 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0059004352394 TM10 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0012004352531 DQ4 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0039003688186 KM4 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0065004330562 TM6 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0054004009297 LJ9 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0016004361901 DQ8 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0063004283262 TM4 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0037003629223 KM2 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0027003402680 GS3 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0077004441217 YJ8 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0074004381526 YJ5 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0014004323233 DQ6 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0042004519492 KM7 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0034005043191 ISW G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0029003211403 GS5 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0066004467556 TM7 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0020004312438 FAMBTIM00001 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0009004358926 DQ1 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0019003391556 FAMBGSD00001 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0078004446352 YJ9 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0038003533120 KM3 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0006005009325 CRW G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0060004271137 TM1 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0008004427978 DQ10 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0044003847092 KM9 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0075004460977 YJ6 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0032003359209 GS8 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0068004308612 TM9 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0001001925288 solidGW1 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-08-01 2014-08-01
snp_cf0072004480948 YJ3 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0017004408398 DQ9 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0043003678601 KM8 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0057005166233 LUPWRUS00002 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0050004056322 LJ5 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0021004183604 FAMICHN00001 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0011004421847 DQ3 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0028003294425 GS4 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0058005367349 LUPWRUS00003 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0013004294407 DQ5 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0033003421249 GS9 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0052004295442 LJ7 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0007003700031 Dingo G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0067004306673 TM8 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0005005244060 CHW G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0024003430593 GS10 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0061004421777 TM2 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0064004397040 TM5 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0010004379704 DQ2 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0070004609709 YJ1 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0004003645815 Basenji G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0031003442226 GS7 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0035004238799 KM10 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0076004484963 YJ7 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0018003628598 FAMBBEM00001 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0026003425554 GS2 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0073004354935 YJ4 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0036003479157 KM1 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
snp_cf0055005388271 LUPWCHN00001 G AGGCCGACCTCCCGGGAGGACAGCGTGGAG CGAGTCTGCCCCTCCAGGTGCGCGGTTATG 2014-07-19 2014-07-19
6.Fasta Information
TCCCGATGCG TCGAGGCTGG AGGCCGACCT CCCGGGAGGA CAGCGTGGAG
G
CGAGTCTGCC CCTCCAGGTG CGCGGTTATG CGGAGGAGAA GTAGGAGGAG