e.g. 1:1246..9423
SNP Detail For snp_cf0031000640050    [See in GBrowse]
1.General Information
SNP ID: snp_cf0031000640050
Organism: Canis familiaris
Individual: GS7
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: C
5'flank: ACCAGGGACACCTGAGAGCCACCACCAAAG
3'flank: CTTCCCACGCACTCAGCTCCGGGGAGGCCA
3.Reference Map information
Chrom Position Reference GS7
Chr14 669297 T C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000001161 110089 - T CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000050108 21656 GAC => GGC ENSCAFP00000035951 7219 D => G
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0062000804389 TM3 Y ACCAGGGACACCTGAGAGCCACCACCAAAG CTTCCCACGCACTCAGCTCCGGGGAGGCCA 2014-07-19 2014-07-19
snp_cf0019000621027 FAMBGSD00001 Y ACCAGGGACACCTGAGAGCCACCACCAAAG CTTCCCACGCACTCAGCTCCGGGGAGGCCA 2014-07-19 2014-07-19
snp_cf0025000604128 GS1 Y ACCAGGGACACCTGAGAGCCACCACCAAAG CTTCCCACGCACTCAGCTCCGGGGAGGCCA 2014-07-19 2014-07-19
snp_cf0061000811900 TM2 Y ACCAGGGACACCTGAGAGCCACCACCAAAG CTTCCCACGCACTCAGCTCCGGGGAGGCCA 2014-07-19 2014-07-19
snp_cf0069000824187 YJ10 Y ACCAGGGACACCTGAGAGCCACCACCAAAG CTTCCCACGCACTCAGCTCCGGGGAGGCCA 2014-07-19 2014-07-19
snp_cf0030000644068 GS6 Y ACCAGGGACACCTGAGAGCCACCACCAAAG CTTCCCACGCACTCAGCTCCGGGGAGGCCA 2014-07-19 2014-07-19
snp_cf0027000621298 GS3 Y ACCAGGGACACCTGAGAGCCACCACCAAAG CTTCCCACGCACTCAGCTCCGGGGAGGCCA 2014-07-19 2014-07-19
snp_cf0058001004964 LUPWRUS00003 C ACCAGGGACACCTGAGAGCCACCACCAAAG CTTCCCACGCACTCAGCTCCGGGGAGGCCA 2014-07-19 2014-07-19
snp_cf0063000791110 TM4 Y ACCAGGGACACCTGAGAGCCACCACCAAAG CTTCCCACGCACTCAGCTCCGGGGAGGCCA 2014-07-19 2014-07-19
snp_cf0072000824118 YJ3 Y ACCAGGGACACCTGAGAGCCACCACCAAAG CTTCCCACGCACTCAGCTCCGGGGAGGCCA 2014-07-19 2014-07-19
snp_cf0043000656659 KM8 Y ACCAGGGACACCTGAGAGCCACCACCAAAG CTTCCCACGCACTCAGCTCCGGGGAGGCCA 2014-07-19 2014-07-19
snp_cf0075000825849 YJ6 Y ACCAGGGACACCTGAGAGCCACCACCAAAG CTTCCCACGCACTCAGCTCCGGGGAGGCCA 2014-07-19 2014-07-19
snp_cf0050000736464 LJ5 Y ACCAGGGACACCTGAGAGCCACCACCAAAG CTTCCCACGCACTCAGCTCCGGGGAGGCCA 2014-07-19 2014-07-19
snp_cf0074000811840 YJ5 Y ACCAGGGACACCTGAGAGCCACCACCAAAG CTTCCCACGCACTCAGCTCCGGGGAGGCCA 2014-07-19 2014-07-19
snp_cf0028000594107 GS4 C ACCAGGGACACCTGAGAGCCACCACCAAAG CTTCCCACGCACTCAGCTCCGGGGAGGCCA 2014-07-19 2014-07-19
snp_cf0037000660319 KM2 Y ACCAGGGACACCTGAGAGCCACCACCAAAG CTTCCCACGCACTCAGCTCCGGGGAGGCCA 2014-07-19 2014-07-19
snp_cf0024000649929 GS10 C ACCAGGGACACCTGAGAGCCACCACCAAAG CTTCCCACGCACTCAGCTCCGGGGAGGCCA 2014-07-19 2014-07-19
snp_cf0026000611169 GS2 C ACCAGGGACACCTGAGAGCCACCACCAAAG CTTCCCACGCACTCAGCTCCGGGGAGGCCA 2014-07-19 2014-07-19
snp_cf0040000705968 KM5 Y ACCAGGGACACCTGAGAGCCACCACCAAAG CTTCCCACGCACTCAGCTCCGGGGAGGCCA 2014-07-19 2014-07-19
snp_cf0070000841664 YJ1 Y ACCAGGGACACCTGAGAGCCACCACCAAAG CTTCCCACGCACTCAGCTCCGGGGAGGCCA 2014-07-19 2014-07-19
snp_cf0032000614406 GS8 C ACCAGGGACACCTGAGAGCCACCACCAAAG CTTCCCACGCACTCAGCTCCGGGGAGGCCA 2014-07-19 2014-07-19
snp_cf0034000944628 ISW Y ACCAGGGACACCTGAGAGCCACCACCAAAG CTTCCCACGCACTCAGCTCCGGGGAGGCCA 2014-07-19 2014-07-19
snp_cf0033000619321 GS9 Y ACCAGGGACACCTGAGAGCCACCACCAAAG CTTCCCACGCACTCAGCTCCGGGGAGGCCA 2014-07-19 2014-07-19
snp_cf0077000818227 YJ8 Y ACCAGGGACACCTGAGAGCCACCACCAAAG CTTCCCACGCACTCAGCTCCGGGGAGGCCA 2014-07-19 2014-07-19
snp_cf0029000562850 GS5 Y ACCAGGGACACCTGAGAGCCACCACCAAAG CTTCCCACGCACTCAGCTCCGGGGAGGCCA 2014-07-19 2014-07-19
6.Fasta Information
CAGACAGGTC TCGGATCTGC ACCAGGGACA CCTGAGAGCC ACCACCAAAG
C
CTTCCCACGC ACTCAGCTCC GGGGAGGCCA GTGGGGGTGC CCCACTGCCC