e.g. 1:1246..9423
SNP Detail For snp_cf0031000640099    [See in GBrowse]
1.General Information
SNP ID: snp_cf0031000640099
Organism: Canis familiaris
Individual: GS7
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: K
5'flank: CCTTCACATTGAGGGTGGCCAGGGTCATCT
3'flank: GTCCCCGAAGCAGCAGGAGTACTGCCCACT
3.Reference Map information
Chrom Position Reference GS7
Chr14 720921 G K
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000001161 58465 - G CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000001792 9112 CAG => AAG ENSCAFP00000001649 3038 Q => K
- ENSCAFT00000050108 9793 CAG => AAG ENSCAFP00000035951 3265 Q => K
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0039000620537 KM4 K CCTTCACATTGAGGGTGGCCAGGGTCATCT GTCCCCGAAGCAGCAGGAGTACTGCCCACT 2014-07-19 2014-07-19
snp_cf0041000778164 KM6 K CCTTCACATTGAGGGTGGCCAGGGTCATCT GTCCCCGAAGCAGCAGGAGTACTGCCCACT 2014-07-19 2014-07-19
snp_cf0028000594148 GS4 T CCTTCACATTGAGGGTGGCCAGGGTCATCT GTCCCCGAAGCAGCAGGAGTACTGCCCACT 2014-07-19 2014-07-19
snp_cf0042000805280 KM7 K CCTTCACATTGAGGGTGGCCAGGGTCATCT GTCCCCGAAGCAGCAGGAGTACTGCCCACT 2014-07-19 2014-07-19
snp_cf0030000644127 GS6 K CCTTCACATTGAGGGTGGCCAGGGTCATCT GTCCCCGAAGCAGCAGGAGTACTGCCCACT 2014-07-19 2014-07-19
snp_cf0034000944661 ISW K CCTTCACATTGAGGGTGGCCAGGGTCATCT GTCCCCGAAGCAGCAGGAGTACTGCCCACT 2014-07-19 2014-07-19
snp_cf0036000635565 KM1 K CCTTCACATTGAGGGTGGCCAGGGTCATCT GTCCCCGAAGCAGCAGGAGTACTGCCCACT 2014-07-19 2014-07-19
snp_cf0019000621072 FAMBGSD00001 K CCTTCACATTGAGGGTGGCCAGGGTCATCT GTCCCCGAAGCAGCAGGAGTACTGCCCACT 2014-07-19 2014-07-19
snp_cf0025000604173 GS1 K CCTTCACATTGAGGGTGGCCAGGGTCATCT GTCCCCGAAGCAGCAGGAGTACTGCCCACT 2014-07-19 2014-07-19
snp_cf0020000792713 FAMBTIM00001 K CCTTCACATTGAGGGTGGCCAGGGTCATCT GTCCCCGAAGCAGCAGGAGTACTGCCCACT 2014-07-19 2014-07-19
snp_cf0017000815461 DQ9 K CCTTCACATTGAGGGTGGCCAGGGTCATCT GTCCCCGAAGCAGCAGGAGTACTGCCCACT 2014-07-19 2014-07-19
snp_cf0005000991568 CHW K CCTTCACATTGAGGGTGGCCAGGGTCATCT GTCCCCGAAGCAGCAGGAGTACTGCCCACT 2014-07-19 2014-07-19
snp_cf0026000611217 GS2 K CCTTCACATTGAGGGTGGCCAGGGTCATCT GTCCCCGAAGCAGCAGGAGTACTGCCCACT 2014-07-19 2014-07-19
snp_cf0024000649970 GS10 T CCTTCACATTGAGGGTGGCCAGGGTCATCT GTCCCCGAAGCAGCAGGAGTACTGCCCACT 2014-07-19 2014-07-19
snp_cf0055001004277 LUPWCHN00001 K CCTTCACATTGAGGGTGGCCAGGGTCATCT GTCCCCGAAGCAGCAGGAGTACTGCCCACT 2014-07-19 2014-07-19
snp_cf0029000562891 GS5 K CCTTCACATTGAGGGTGGCCAGGGTCATCT GTCCCCGAAGCAGCAGGAGTACTGCCCACT 2014-07-19 2014-07-19
snp_cf0044000713067 KM9 K CCTTCACATTGAGGGTGGCCAGGGTCATCT GTCCCCGAAGCAGCAGGAGTACTGCCCACT 2014-07-19 2014-07-19
6.Fasta Information
TGGCAGGCAG GGGTGCTTAC CCTTCACATT GAGGGTGGCC AGGGTCATCT
K
GTCCCCGAAG CAGCAGGAGT ACTGCCCACT GTCCTGGGGC CGCAGGTCCC