e.g. 1:1246..9423
SNP Detail For snp_cf0031000640110    [See in GBrowse]
1.General Information
SNP ID: snp_cf0031000640110
Organism: Canis familiaris
Individual: GS7
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: R
5'flank: AAGGTGGCCTCACTGCCCTCCTCGGCCACC
3'flank: CGGCGCTCAACCCCGACGTGAACTTGACCA
3.Reference Map information
Chrom Position Reference GS7
Chr14 731296 G R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000001161 48090 - G CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000001792 4892 GCG => GTG ENSCAFP00000001649 1631 A => V
- ENSCAFT00000050108 5726 GCG => GTG ENSCAFP00000035951 1909 A => V
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0062000804441 TM3 R AAGGTGGCCTCACTGCCCTCCTCGGCCACC CGGCGCTCAACCCCGACGTGAACTTGACCA 2014-07-19 2014-07-19
snp_cf0072000824174 YJ3 R AAGGTGGCCTCACTGCCCTCCTCGGCCACC CGGCGCTCAACCCCGACGTGAACTTGACCA 2014-07-19 2014-07-19
snp_cf0069000824255 YJ10 R AAGGTGGCCTCACTGCCCTCCTCGGCCACC CGGCGCTCAACCCCGACGTGAACTTGACCA 2014-07-19 2014-07-19
snp_cf0061000811966 TM2 R AAGGTGGCCTCACTGCCCTCCTCGGCCACC CGGCGCTCAACCCCGACGTGAACTTGACCA 2014-07-19 2014-07-19
snp_cf0058001005020 LUPWRUS00003 R AAGGTGGCCTCACTGCCCTCCTCGGCCACC CGGCGCTCAACCCCGACGTGAACTTGACCA 2014-07-19 2014-07-19
snp_cf0030000644137 GS6 R AAGGTGGCCTCACTGCCCTCCTCGGCCACC CGGCGCTCAACCCCGACGTGAACTTGACCA 2014-07-19 2014-07-19
snp_cf0034000944672 ISW A AAGGTGGCCTCACTGCCCTCCTCGGCCACC CGGCGCTCAACCCCGACGTGAACTTGACCA 2014-07-19 2014-07-19
snp_cf0027000621359 GS3 R AAGGTGGCCTCACTGCCCTCCTCGGCCACC CGGCGCTCAACCCCGACGTGAACTTGACCA 2014-07-19 2014-07-19
snp_cf0032000614462 GS8 A AAGGTGGCCTCACTGCCCTCCTCGGCCACC CGGCGCTCAACCCCGACGTGAACTTGACCA 2014-07-19 2014-07-19
snp_cf0033000619380 GS9 R AAGGTGGCCTCACTGCCCTCCTCGGCCACC CGGCGCTCAACCCCGACGTGAACTTGACCA 2014-07-19 2014-07-19
snp_cf0077000818284 YJ8 R AAGGTGGCCTCACTGCCCTCCTCGGCCACC CGGCGCTCAACCCCGACGTGAACTTGACCA 2014-07-19 2014-07-19
snp_cf0063000791160 TM4 R AAGGTGGCCTCACTGCCCTCCTCGGCCACC CGGCGCTCAACCCCGACGTGAACTTGACCA 2014-07-19 2014-07-19
snp_cf0040000706025 KM5 R AAGGTGGCCTCACTGCCCTCCTCGGCCACC CGGCGCTCAACCCCGACGTGAACTTGACCA 2014-07-19 2014-07-19
snp_cf0070000841719 YJ1 R AAGGTGGCCTCACTGCCCTCCTCGGCCACC CGGCGCTCAACCCCGACGTGAACTTGACCA 2014-07-19 2014-07-19
snp_cf0075000825906 YJ6 R AAGGTGGCCTCACTGCCCTCCTCGGCCACC CGGCGCTCAACCCCGACGTGAACTTGACCA 2014-07-19 2014-07-19
snp_cf0037000660384 KM2 R AAGGTGGCCTCACTGCCCTCCTCGGCCACC CGGCGCTCAACCCCGACGTGAACTTGACCA 2014-07-19 2014-07-19
snp_cf0043000656714 KM8 R AAGGTGGCCTCACTGCCCTCCTCGGCCACC CGGCGCTCAACCCCGACGTGAACTTGACCA 2014-07-19 2014-07-19
6.Fasta Information
TGGGGGACAC GACGCACTGG AAGGTGGCCT CACTGCCCTC CTCGGCCACC
R
CGGCGCTCAA CCCCGACGTG AACTTGACCA TGCGGGGAGC TGCGGACGGG