e.g. 1:1246..9423
SNP Detail For snp_cf0032000000001    [See in GBrowse]
1.General Information
SNP ID: snp_cf0032000000001
Organism: Canis familiaris
Individual: GS8
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: M
5'flank: GGTTCCAACTCACATGTACGAGTGGGTAGC
3'flank: GACTTCTGCCTCCCAGGAATACACAGTTCT
3.Reference Map information
Chrom Position Reference GS8
Chr1 7976 C M
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0005000000003 CHW A GGTTCCAACTCACATGTACGAGTGGGTAGC GACTTCTGCCTCCCAGGAATACACAGTTCT 2014-07-19 2014-07-19
snp_cf0058000000002 LUPWRUS00003 A GGTTCCAACTCACATGTACGAGTGGGTAGC GACTTCTGCCTCCCAGGAATACACAGTTCT 2014-07-19 2014-07-19
snp_cf0034000000003 ISW A GGTTCCAACTCACATGTACGAGTGGGTAGC GACTTCTGCCTCCCAGGAATACACAGTTCT 2014-07-19 2014-07-19
6.Fasta Information
CTTCAATCAG AGTGTAGCTA GGTTCCAACT CACATGTACG AGTGGGTAGC
M
GACTTCTGCC TCCCAGGAAT ACACAGTTCT GACAGTTGAG CTTATGGCCT