e.g. 1:1246..9423
SNP Detail For snp_cf0032000000002    [See in GBrowse]
1.General Information
SNP ID: snp_cf0032000000002
Organism: Canis familiaris
Individual: GS8
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: Y
5'flank: CAGCGTTAGCACATGTACAGCCATCCCAGG
3'flank: CCCTGTGAATAAGAGCTGAAATTTACATTG
3.Reference Map information
Chrom Position Reference GS8
Chr1 13255 C Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0016000000009 DQ8 Y CAGCGTTAGCACATGTACAGCCATCCCAGG CCCTGTGAATAAGAGCTGAAATTTACATTG 2014-07-19 2014-07-19
snp_cf0041000000001 KM6 T CAGCGTTAGCACATGTACAGCCATCCCAGG CCCTGTGAATAAGAGCTGAAATTTACATTG 2014-07-19 2014-07-19
snp_cf0048000000002 LJ3 T CAGCGTTAGCACATGTACAGCCATCCCAGG CCCTGTGAATAAGAGCTGAAATTTACATTG 2014-07-19 2014-07-19
snp_cf0042000000005 KM7 T CAGCGTTAGCACATGTACAGCCATCCCAGG CCCTGTGAATAAGAGCTGAAATTTACATTG 2014-07-19 2014-07-19
snp_cf0067000000001 TM8 T CAGCGTTAGCACATGTACAGCCATCCCAGG CCCTGTGAATAAGAGCTGAAATTTACATTG 2014-07-19 2014-07-19
snp_cf0070000000005 YJ1 Y CAGCGTTAGCACATGTACAGCCATCCCAGG CCCTGTGAATAAGAGCTGAAATTTACATTG 2014-07-19 2014-07-19
snp_cf0039000000004 KM4 Y CAGCGTTAGCACATGTACAGCCATCCCAGG CCCTGTGAATAAGAGCTGAAATTTACATTG 2014-07-19 2014-07-19
snp_cf0036000000002 KM1 T CAGCGTTAGCACATGTACAGCCATCCCAGG CCCTGTGAATAAGAGCTGAAATTTACATTG 2014-07-19 2014-07-19
snp_cf0008000000002 DQ10 T CAGCGTTAGCACATGTACAGCCATCCCAGG CCCTGTGAATAAGAGCTGAAATTTACATTG 2014-07-19 2014-07-19
snp_cf0037000000001 KM2 T CAGCGTTAGCACATGTACAGCCATCCCAGG CCCTGTGAATAAGAGCTGAAATTTACATTG 2014-07-19 2014-07-19
snp_cf0052000000003 LJ7 T CAGCGTTAGCACATGTACAGCCATCCCAGG CCCTGTGAATAAGAGCTGAAATTTACATTG 2014-07-19 2014-07-19
snp_cf0044000000002 KM9 Y CAGCGTTAGCACATGTACAGCCATCCCAGG CCCTGTGAATAAGAGCTGAAATTTACATTG 2014-07-19 2014-07-19
snp_cf0038000000001 KM3 T CAGCGTTAGCACATGTACAGCCATCCCAGG CCCTGTGAATAAGAGCTGAAATTTACATTG 2014-07-19 2014-07-19
6.Fasta Information
AGGCCATTTC ACTTTATGTT CAGCGTTAGC ACATGTACAG CCATCCCAGG
Y
CCCTGTGAAT AAGAGCTGAA ATTTACATTG CTTCAGTTAC AGGAAAAAAA