e.g. 1:1246..9423
SNP Detail For snp_cf0032000000008    [See in GBrowse]
1.General Information
SNP ID: snp_cf0032000000008
Organism: Canis familiaris
Individual: GS8
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: Y
5'flank: GCTGAACGCCTTGTCCAAAAGCATCTTACT
3'flank: ATGAGAGTTGAGCTCAACATCAGTCCCTCA
3.Reference Map information
Chrom Position Reference GS8
Chr1 32313 T Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0057000000011 LUPWRUS00002 C GCTGAACGCCTTGTCCAAAAGCATCTTACT ATGAGAGTTGAGCTCAACATCAGTCCCTCA 2014-07-19 2014-07-19
snp_cf0006000000011 CRW C GCTGAACGCCTTGTCCAAAAGCATCTTACT ATGAGAGTTGAGCTCAACATCAGTCCCTCA 2014-07-19 2014-07-19
snp_cf0029000000007 GS5 C GCTGAACGCCTTGTCCAAAAGCATCTTACT ATGAGAGTTGAGCTCAACATCAGTCCCTCA 2014-07-19 2014-07-19
snp_cf0042000000011 KM7 Y GCTGAACGCCTTGTCCAAAAGCATCTTACT ATGAGAGTTGAGCTCAACATCAGTCCCTCA 2014-07-19 2014-07-19
snp_cf0027000000011 GS3 Y GCTGAACGCCTTGTCCAAAAGCATCTTACT ATGAGAGTTGAGCTCAACATCAGTCCCTCA 2014-07-19 2014-07-19
snp_cf0041000000008 KM6 Y GCTGAACGCCTTGTCCAAAAGCATCTTACT ATGAGAGTTGAGCTCAACATCAGTCCCTCA 2014-07-19 2014-07-19
snp_cf0058000000015 LUPWRUS00003 Y GCTGAACGCCTTGTCCAAAAGCATCTTACT ATGAGAGTTGAGCTCAACATCAGTCCCTCA 2014-07-19 2014-07-19
snp_cf0026000000008 GS2 C GCTGAACGCCTTGTCCAAAAGCATCTTACT ATGAGAGTTGAGCTCAACATCAGTCCCTCA 2014-07-19 2014-07-19
snp_cf0050000000016 LJ5 Y GCTGAACGCCTTGTCCAAAAGCATCTTACT ATGAGAGTTGAGCTCAACATCAGTCCCTCA 2014-07-19 2014-07-19
snp_cf0025000000009 GS1 Y GCTGAACGCCTTGTCCAAAAGCATCTTACT ATGAGAGTTGAGCTCAACATCAGTCCCTCA 2014-07-19 2014-07-19
snp_cf0028000000006 GS4 C GCTGAACGCCTTGTCCAAAAGCATCTTACT ATGAGAGTTGAGCTCAACATCAGTCCCTCA 2014-07-19 2014-07-19
snp_cf0030000000007 GS6 Y GCTGAACGCCTTGTCCAAAAGCATCTTACT ATGAGAGTTGAGCTCAACATCAGTCCCTCA 2014-07-19 2014-07-19
snp_cf0031000000010 GS7 C GCTGAACGCCTTGTCCAAAAGCATCTTACT ATGAGAGTTGAGCTCAACATCAGTCCCTCA 2014-07-19 2014-07-19
snp_cf0048000000011 LJ3 Y GCTGAACGCCTTGTCCAAAAGCATCTTACT ATGAGAGTTGAGCTCAACATCAGTCCCTCA 2014-07-19 2014-07-19
snp_cf0019000000010 FAMBGSD00001 Y GCTGAACGCCTTGTCCAAAAGCATCTTACT ATGAGAGTTGAGCTCAACATCAGTCCCTCA 2014-07-19 2014-07-19
snp_cf0033000000007 GS9 Y GCTGAACGCCTTGTCCAAAAGCATCTTACT ATGAGAGTTGAGCTCAACATCAGTCCCTCA 2014-07-19 2014-07-19
snp_cf0021000000011 FAMICHN00001 Y GCTGAACGCCTTGTCCAAAAGCATCTTACT ATGAGAGTTGAGCTCAACATCAGTCCCTCA 2014-07-19 2014-07-19
snp_cf0040000000011 KM5 Y GCTGAACGCCTTGTCCAAAAGCATCTTACT ATGAGAGTTGAGCTCAACATCAGTCCCTCA 2014-07-19 2014-07-19
snp_cf0024000000009 GS10 C GCTGAACGCCTTGTCCAAAAGCATCTTACT ATGAGAGTTGAGCTCAACATCAGTCCCTCA 2014-07-19 2014-07-19
6.Fasta Information
GTTCCATACG TGAGAAGGTA GCTGAACGCC TTGTCCAAAA GCATCTTACT
Y
ATGAGAGTTG AGCTCAACAT CAGTCCCTCA CAGTTCCACA CTGCCTGCAG