e.g. 1:1246..9423
SNP Detail For snp_cf0032000382570    [See in GBrowse]
1.General Information
SNP ID: snp_cf0032000382570
Organism: Canis familiaris
Individual: GS8
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs22200642  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: CTTTCGATGGACACCGAGGCGCCTTCCACA
3'flank: TTTGGCTATTGTGGACATTGCTGCTATAAA
3.Reference Map information
Chrom Position Reference GS8
Chr12 98228 C G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000000367 83660 - C intron
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0075000527697 YJ6 S CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0018000418469 FAMBBEM00001 S CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0023000475848 FAMICHN00003 G CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0029000337206 GS5 S CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0038000404200 KM3 G CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0045000438308 LJ10 S CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0021000481978 FAMICHN00001 S CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0034000616796 ISW S CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0067000502332 TM8 G CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0070000534555 YJ1 S CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0015000506172 DQ7 S CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0022000471109 FAMICHN00002 G CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0055000646563 LUPWCHN00001 G CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0003000275602 dbSNP139 G CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0046000454092 LJ1 G CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0039000401818 KM4 G CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0026000389314 GS2 G CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0025000371196 GS1 G CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0057000630589 LUPWRUS00002 S CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0060000521169 TM1 S CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0031000389481 GS7 S CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0024000418909 GS10 S CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0049000520247 LJ4 S CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0064000514190 TM5 S CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0047000476895 LJ2 G CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0073000513926 YJ4 S CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0056000651706 LUPWRUS00001 G CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0037000411604 KM2 G CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0059000515373 TM10 G CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0041000482231 KM6 G CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0008000501402 DQ10 S CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0068000494054 TM9 G CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0002000332415 CID1 G CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-08-02 2014-08-02
snp_cf0058000641482 LUPWRUS00003 S CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0053000492396 LJ8 S CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0012000503633 DQ4 S CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0048000481593 LJ3 S CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0005000626637 CHW G CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0010000504461 DQ2 S CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0013000501037 DQ5 G CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0036000396250 KM1 G CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0044000444362 KM9 S CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0030000395110 GS6 S CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0009000505225 DQ1 S CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0050000457109 LJ5 G CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0011000511053 DQ3 S CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0007000423320 Dingo S CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0074000515687 YJ5 S CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0014000498698 DQ6 G CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0027000385943 GS3 G CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0052000492290 LJ7 S CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0072000524258 YJ3 S CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0042000496541 KM7 G CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0040000440259 KM5 G CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0016000508899 DQ8 S CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0020000499746 FAMBTIM00001 G CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0063000506309 TM4 S CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0061000514506 TM2 S CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0017000522746 DQ9 G CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0071000519156 YJ2 G CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0019000385617 FAMBGSD00001 G CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0051000505618 LJ6 G CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0033000405563 GS9 S CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
snp_cf0065000482399 TM6 G CTTTCGATGGACACCGAGGCGCCTTCCACA TTTGGCTATTGTGGACATTGCTGCTATAAA 2014-07-19 2014-07-19
6.Fasta Information
CCTCTGCTTT ATCCATTCAT CTTTCGATGG ACACCGAGGC GCCTTCCACA
G
TTTGGCTATT GTGGACATTG CTGCTATAAA CATCGGGGTG CAGGTGTCCC