e.g. 1:1246..9423
SNP Detail For snp_cf0032000382575    [See in GBrowse]
1.General Information
SNP ID: snp_cf0032000382575
Organism: Canis familiaris
Individual: GS8
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: T
5'flank: CTAAAGCACAACACAAAATTATATCTAGGC
3'flank: GGGGGGTGGTACTCAAGTCCTTTAATATCA
3.Reference Map information
Chrom Position Reference GS8
Chr12 99978 A T
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000000367 81910 - A intron
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0061000514510 TM2 W CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0072000524264 YJ3 W CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0057000630596 LUPWRUS00002 W CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0038000404205 KM3 T CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0063000506313 TM4 W CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0051000505621 LJ6 T CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0015000506176 DQ7 W CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0019000385621 FAMBGSD00001 T CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0073000513932 YJ4 W CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0045000438312 LJ10 W CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0046000454095 LJ1 T CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0026000389318 GS2 T CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0065000482402 TM6 T CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0056000651710 LUPWRUS00001 T CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0053000492402 LJ8 W CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0018000418476 FAMBBEM00001 W CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0049000520254 LJ4 W CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0037000411608 KM2 T CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0047000476898 LJ2 T CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0022000471113 FAMICHN00002 T CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0059000515376 TM10 T CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0009000505231 DQ1 W CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0021000481981 FAMICHN00001 W CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0064000514196 TM5 W CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0039000401822 KM4 T CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0058000641488 LUPWRUS00003 W CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0014000498701 DQ6 T CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0040000440263 KM5 T CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0041000482236 KM6 T CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0060000521172 TM1 W CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0068000494057 TM9 T CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0010000504464 DQ2 W CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0002000332419 CID1 T CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-08-02 2014-08-02
snp_cf0034000616801 ISW W CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0025000371203 GS1 W CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0016000508902 DQ8 W CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0012000503638 DQ4 W CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0048000481599 LJ3 W CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0071000519161 YJ2 T CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0011000511056 DQ3 W CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0031000389487 GS7 W CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0075000527704 YJ6 W CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0030000395117 GS6 W CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0033000405570 GS9 W CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0024000418916 GS10 W CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0023000475851 FAMICHN00003 T CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0052000492295 LJ7 W CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0055000646567 LUPWCHN00001 W CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0005000626641 CHW T CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0013000501040 DQ5 T CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0007000423326 Dingo W CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0029000337213 GS5 W CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0044000444369 KM9 W CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0027000385947 GS3 T CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0042000496546 KM7 T CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0020000499749 FAMBTIM00001 T CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0036000396254 KM1 T CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0067000502336 TM8 T CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0017000522749 DQ9 T CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0070000534561 YJ1 W CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0008000501408 DQ10 W CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0074000515691 YJ5 W CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
snp_cf0050000457113 LJ5 T CTAAAGCACAACACAAAATTATATCTAGGC GGGGGGTGGTACTCAAGTCCTTTAATATCA 2014-07-19 2014-07-19
6.Fasta Information
AAAATTGCGA TTCAATATAC CTAAAGCACA ACACAAAATT ATATCTAGGC
T
GGGGGGTGGT ACTCAAGTCC TTTAATATCA GCTAGTCCAC CTGTACCACC