e.g. 1:1246..9423
SNP Detail For snp_cf0032000382576    [See in GBrowse]
1.General Information
SNP ID: snp_cf0032000382576
Organism: Canis familiaris
Individual: GS8
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: T
5'flank: ATTTCAATAAATACAGTGCAGAACTACAAT
3'flank: GTCTTCTGCTTATGATTTCCTTCCTTCCTT
3.Reference Map information
Chrom Position Reference GS8
Chr12 100220 G T
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000000367 81668 - G intron
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0061000514512 TM2 K ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0072000524266 YJ3 K ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0057000630598 LUPWRUS00002 K ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0063000506315 TM4 K ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0038000404206 KM3 T ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0051000505622 LJ6 T ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0073000513934 YJ4 K ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0015000506178 DQ7 K ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0019000385622 FAMBGSD00001 T ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0045000438313 LJ10 K ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0046000454096 LJ1 T ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0065000482403 TM6 T ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0026000389319 GS2 T ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0056000651711 LUPWRUS00001 T ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0048000481601 LJ3 K ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0058000641490 LUPWRUS00003 K ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0018000418478 FAMBBEM00001 K ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0049000520256 LJ4 K ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0022000471114 FAMICHN00002 T ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0047000476899 LJ2 T ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0059000515377 TM10 T ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0037000411609 KM2 T ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0021000481982 FAMICHN00001 K ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0009000505233 DQ1 K ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0039000401823 KM4 T ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0053000492404 LJ8 K ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0064000514198 TM5 K ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0014000498702 DQ6 T ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0040000440264 KM5 T ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0030000395119 GS6 K ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0020000499750 FAMBTIM00001 T ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0060000521173 TM1 K ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0041000482237 KM6 T ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0068000494058 TM9 T ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0034000616803 ISW K ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0010000504465 DQ2 K ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0025000371205 GS1 K ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0016000508903 DQ8 K ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0071000519162 YJ2 T ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0012000503640 DQ4 K ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0075000527706 YJ6 K ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0031000389489 GS7 K ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0007000423328 Dingo K ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0033000405572 GS9 K ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0024000418918 GS10 K ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0023000475852 FAMICHN00003 T ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0008000501410 DQ10 K ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0055000646569 LUPWCHN00001 K ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0013000501041 DQ5 T ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0027000385948 GS3 T ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0017000522750 DQ9 T ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0005000626642 CHW T ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0029000337215 GS5 K ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0011000511057 DQ3 K ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0067000502337 TM8 T ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0042000496547 KM7 T ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0052000492297 LJ7 K ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0036000396255 KM1 T ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0044000444371 KM9 K ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0070000534563 YJ1 K ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0074000515693 YJ5 K ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
snp_cf0050000457114 LJ5 T ATTTCAATAAATACAGTGCAGAACTACAAT GTCTTCTGCTTATGATTTCCTTCCTTCCTT 2014-07-19 2014-07-19
6.Fasta Information
ATCCACATAC ATGCAGATTT ATTTCAATAA ATACAGTGCA GAACTACAAT
T
GTCTTCTGCT TATGATTTCC TTCCTTCCTT CCTTCCTTCC TTCCTTCCTT