e.g. 1:1246..9423
SNP Detail For snp_cf0032000382578    [See in GBrowse]
1.General Information
SNP ID: snp_cf0032000382578
Organism: Canis familiaris
Individual: GS8
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: A
5'flank: TATGATTTTCTTAATAATATTTTCTTTTCT
3'flank: TAGCTTACTTTATTTTAAGAATACAATATA
3.Reference Map information
Chrom Position Reference GS8
Chr12 100553 G A
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000000367 81335 - G intron
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0026000389321 GS2 A TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0072000524267 YJ3 R TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0074000515696 YJ5 R TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0061000514515 TM2 R TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0063000506318 TM4 R TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0073000513935 YJ4 R TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0046000454098 LJ1 A TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0019000385624 FAMBGSD00001 A TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0056000651713 LUPWRUS00001 A TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0051000505624 LJ6 A TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0065000482405 TM6 A TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0064000514200 TM5 R TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0002000332421 CID1 A TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-08-02 2014-08-02
snp_cf0048000481603 LJ3 R TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0058000641492 LUPWRUS00003 R TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0045000438315 LJ10 R TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0059000515379 TM10 A TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0021000481984 FAMICHN00001 R TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0022000471116 FAMICHN00002 A TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0009000505235 DQ1 R TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0010000504467 DQ2 R TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0038000404208 KM3 A TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0039000401825 KM4 A TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0053000492406 LJ8 R TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0027000385950 GS3 A TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0020000499752 FAMBTIM00001 A TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0060000521175 TM1 R TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0024000418920 GS10 R TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0040000440266 KM5 A TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0031000389491 GS7 R TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0034000616805 ISW R TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0025000371207 GS1 R TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0007000423330 Dingo R TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0014000498704 DQ6 A TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0016000508905 DQ8 R TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0071000519164 YJ2 A TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0018000418480 FAMBBEM00001 R TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0047000476901 LJ2 A TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0049000520258 LJ4 R TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0075000527708 YJ6 R TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0012000503642 DQ4 R TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0041000482239 KM6 A TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0037000411611 KM2 A TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0033000405574 GS9 R TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0068000494060 TM9 A TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0008000501412 DQ10 R TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0023000475854 FAMICHN00003 A TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0057000630600 LUPWRUS00002 R TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0005000626644 CHW A TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0011000511059 DQ3 R TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0036000396257 KM1 A TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0013000501043 DQ5 A TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0067000502339 TM8 A TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0015000506181 DQ7 R TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0029000337217 GS5 R TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0042000496549 KM7 A TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0052000492299 LJ7 R TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0017000522752 DQ9 A TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0044000444373 KM9 R TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0030000395121 GS6 R TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0050000457116 LJ5 A TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0070000534565 YJ1 R TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
snp_cf0055000646571 LUPWCHN00001 R TATGATTTTCTTAATAATATTTTCTTTTCT TAGCTTACTTTATTTTAAGAATACAATATA 2014-07-19 2014-07-19
6.Fasta Information
GCCACCCAGG TACTCCTCCT TATGATTTTC TTAATAATAT TTTCTTTTCT
A
TAGCTTACTT TATTTTAAGA ATACAATATA TGAGACATAG AAAATATGTG