e.g. 1:1246..9423
SNP Detail For snp_cf0033000811178    [See in GBrowse]
1.General Information
SNP ID: snp_cf0033000811178
Organism: Canis familiaris
Individual: GS9
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: A
5'flank: AGGACGGTCGGGGAAGTTGCCTTGGGCCAG
3'flank: CGAGCGTGGGGGGGGGCCCTGGGCTCGCCC
3.Reference Map information
Chrom Position Reference GS9
Chr16 93990 G A
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000025598 278 + G intron
ENSCAFG00000031089 379 - G CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000048823 379 CCT => TCT ENSCAFP00000041015 127 P => S
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0024000845681 GS10 A AGGACGGTCGGGGAAGTTGCCTTGGGCCAG CGAGCGTGGGGGGGGGCCCTGGGCTCGCCC 2014-07-19 2014-07-19
snp_cf0031000820103 GS7 A AGGACGGTCGGGGAAGTTGCCTTGGGCCAG CGAGCGTGGGGGGGGGCCCTGGGCTCGCCC 2014-07-19 2014-07-19
snp_cf0076001075794 YJ7 R AGGACGGTCGGGGAAGTTGCCTTGGGCCAG CGAGCGTGGGGGGGGGCCCTGGGCTCGCCC 2014-07-19 2014-07-19
snp_cf0026000806352 GS2 A AGGACGGTCGGGGAAGTTGCCTTGGGCCAG CGAGCGTGGGGGGGGGCCCTGGGCTCGCCC 2014-07-19 2014-07-19
snp_cf0036000825150 KM1 R AGGACGGTCGGGGAAGTTGCCTTGGGCCAG CGAGCGTGGGGGGGGGCCCTGGGCTCGCCC 2014-07-19 2014-07-19
snp_cf0069001075965 YJ10 A AGGACGGTCGGGGAAGTTGCCTTGGGCCAG CGAGCGTGGGGGGGGGCCCTGGGCTCGCCC 2014-07-19 2014-07-19
snp_cf0068001005175 TM9 A AGGACGGTCGGGGAAGTTGCCTTGGGCCAG CGAGCGTGGGGGGGGGCCCTGGGCTCGCCC 2014-07-19 2014-07-19
snp_cf0043000867735 KM8 A AGGACGGTCGGGGAAGTTGCCTTGGGCCAG CGAGCGTGGGGGGGGGCCCTGGGCTCGCCC 2014-07-19 2014-07-19
snp_cf0066001064398 TM7 R AGGACGGTCGGGGAAGTTGCCTTGGGCCAG CGAGCGTGGGGGGGGGCCCTGGGCTCGCCC 2014-07-19 2014-07-19
snp_cf0038000798639 KM3 A AGGACGGTCGGGGAAGTTGCCTTGGGCCAG CGAGCGTGGGGGGGGGCCCTGGGCTCGCCC 2014-07-19 2014-07-19
snp_cf0078001065183 YJ9 R AGGACGGTCGGGGAAGTTGCCTTGGGCCAG CGAGCGTGGGGGGGGGCCCTGGGCTCGCCC 2014-07-19 2014-07-19
snp_cf0039000836140 KM4 A AGGACGGTCGGGGAAGTTGCCTTGGGCCAG CGAGCGTGGGGGGGGGCCCTGGGCTCGCCC 2014-07-19 2014-07-19
snp_cf0040000920811 KM5 A AGGACGGTCGGGGAAGTTGCCTTGGGCCAG CGAGCGTGGGGGGGGGCCCTGGGCTCGCCC 2014-07-19 2014-07-19
snp_cf0065001013928 TM6 A AGGACGGTCGGGGAAGTTGCCTTGGGCCAG CGAGCGTGGGGGGGGGCCCTGGGCTCGCCC 2014-07-19 2014-07-19
snp_cf0077001053359 YJ8 A AGGACGGTCGGGGAAGTTGCCTTGGGCCAG CGAGCGTGGGGGGGGGCCCTGGGCTCGCCC 2014-07-19 2014-07-19
snp_cf0028000767933 GS4 A AGGACGGTCGGGGAAGTTGCCTTGGGCCAG CGAGCGTGGGGGGGGGCCCTGGGCTCGCCC 2014-07-19 2014-07-19
snp_cf0074001060337 YJ5 R AGGACGGTCGGGGAAGTTGCCTTGGGCCAG CGAGCGTGGGGGGGGGCCCTGGGCTCGCCC 2014-07-19 2014-07-19
snp_cf0061001055591 TM2 R AGGACGGTCGGGGAAGTTGCCTTGGGCCAG CGAGCGTGGGGGGGGGCCCTGGGCTCGCCC 2014-07-19 2014-07-19
snp_cf0073001057217 YJ4 A AGGACGGTCGGGGAAGTTGCCTTGGGCCAG CGAGCGTGGGGGGGGGCCCTGGGCTCGCCC 2014-07-19 2014-07-19
snp_cf0041001036796 KM6 R AGGACGGTCGGGGAAGTTGCCTTGGGCCAG CGAGCGTGGGGGGGGGCCCTGGGCTCGCCC 2014-07-19 2014-07-19
snp_cf0071001064843 YJ2 A AGGACGGTCGGGGAAGTTGCCTTGGGCCAG CGAGCGTGGGGGGGGGCCCTGGGCTCGCCC 2014-07-19 2014-07-19
6.Fasta Information
CGCGGGCTGA GCCGGCGCCC AGGACGGTCG GGGAAGTTGC CTTGGGCCAG
A
CGAGCGTGGG GGGGGGCCCT GGGCTCGCCC CGGCTCGGCC TGCAGCCCTG