e.g. 1:1246..9423
SNP Detail For snp_cf0033000811305    [See in GBrowse]
1.General Information
SNP ID: snp_cf0033000811305
Organism: Canis familiaris
Individual: GS9
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: R
5'flank: CTGTTCATCTCCAGGGCCCCCTCAGTCACC
3'flank: TCATCCTCAGTGGCTCCCAGTCCTATGACC
3.Reference Map information
Chrom Position Reference GS9
Chr16 139772 A R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000014734 16047 + A CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000042831 1969 ATC => GTC ENSCAFP00000040839 657 I => V
+ ENSCAFT00000023399 1477 ATC => GTC ENSCAFP00000021730 493 I => V
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0010001043224 DQ2 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0007000883843 Dingo R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0012001047854 DQ4 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0011001055668 DQ3 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0072001071590 YJ3 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0068001005310 TM9 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0025000803092 GS1 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0028000768083 GS4 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0038000798788 KM3 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0075001070654 YJ6 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0001000434686 solidGW1 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-08-01 2014-08-01
snp_cf0036000825304 KM1 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0020001032304 FAMBTIM00001 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0013001008612 DQ5 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0073001057371 YJ4 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0005001280032 CHW R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0014001026578 DQ6 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0062001045404 TM3 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0044000923228 KM9 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0042001073498 KM7 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0040000920947 KM5 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0064001051594 TM5 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0006001210214 CRW R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0071001064971 YJ2 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0052001017739 LJ7 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0030000829895 GS6 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0066001064549 TM7 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0027000808238 GS3 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0057001260866 LUPWRUS00002 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0051001043550 LJ6 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0037000884388 KM2 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0023000992107 FAMICHN00003 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0034001232068 ISW R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0058001306932 LUPWRUS00003 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0056001322956 LUPWRUS00001 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0032000801397 GS8 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0067001009274 TM8 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0024000845833 GS10 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0065001014085 TM6 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0016001038578 DQ8 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0019000807407 FAMBGSD00001 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0070001099322 YJ1 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0049001050474 LJ4 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0063001028065 TM4 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0055001308853 LUPWCHN00001 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0059001051875 TM10 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0018000867921 FAMBBEM00001 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0069001076109 YJ10 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0053001016186 LJ8 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0039000836294 KM4 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0043000867886 KM8 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0060001035796 TM1 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0017001057857 DQ9 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0031000820253 GS7 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0076001075950 YJ7 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0061001055709 TM2 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0074001060492 YJ5 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0029000749402 GS5 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0041001036947 KM6 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0002000678181 CID1 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-08-02 2014-08-02
snp_cf0048000994959 LJ3 G CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0021000986632 FAMICHN00001 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0026000806503 GS2 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0009001051863 DQ1 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0004000866320 Basenji R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0035001011383 KM10 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0077001053513 YJ8 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0008001033013 DQ10 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0078001065338 YJ9 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
snp_cf0015001045599 DQ7 R CTGTTCATCTCCAGGGCCCCCTCAGTCACC TCATCCTCAGTGGCTCCCAGTCCTATGACC 2014-07-19 2014-07-19
6.Fasta Information
TCATCTCCGA GGGCACGCAA CTGTTCATCT CCAGGGCCCC CTCAGTCACC
R
TCATCCTCAG TGGCTCCCAG TCCTATGACC CAGACAACCC CGGGGCCACC