e.g. 1:1246..9423
SNP Detail For snp_cf0033000811321    [See in GBrowse]
1.General Information
SNP ID: snp_cf0033000811321
Organism: Canis familiaris
Individual: GS9
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: Y
5'flank: CGAGCTGCCCGGAGCCCCGTGGGACGGGTG
3'flank: GGCGTCCTCACAGAAGCAGTCACCACAGCC
3.Reference Map information
Chrom Position Reference GS9
Chr16 145476 T Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000014734 21751 + T CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000042831 2528 GTG => GCG ENSCAFP00000040839 843 V => A
+ ENSCAFT00000023399 2036 GTG => GCG ENSCAFP00000021730 679 V => A
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0009001051878 DQ1 Y CGAGCTGCCCGGAGCCCCGTGGGACGGGTG GGCGTCCTCACAGAAGCAGTCACCACAGCC 2014-07-19 2014-07-19
snp_cf0016001038594 DQ8 Y CGAGCTGCCCGGAGCCCCGTGGGACGGGTG GGCGTCCTCACAGAAGCAGTCACCACAGCC 2014-07-19 2014-07-19
snp_cf0060001035811 TM1 Y CGAGCTGCCCGGAGCCCCGTGGGACGGGTG GGCGTCCTCACAGAAGCAGTCACCACAGCC 2014-07-19 2014-07-19
snp_cf0059001051893 TM10 Y CGAGCTGCCCGGAGCCCCGTGGGACGGGTG GGCGTCCTCACAGAAGCAGTCACCACAGCC 2014-07-19 2014-07-19
snp_cf0029000749418 GS5 Y CGAGCTGCCCGGAGCCCCGTGGGACGGGTG GGCGTCCTCACAGAAGCAGTCACCACAGCC 2014-07-19 2014-07-19
snp_cf0039000836311 KM4 Y CGAGCTGCCCGGAGCCCCGTGGGACGGGTG GGCGTCCTCACAGAAGCAGTCACCACAGCC 2014-07-19 2014-07-19
snp_cf0069001076127 YJ10 Y CGAGCTGCCCGGAGCCCCGTGGGACGGGTG GGCGTCCTCACAGAAGCAGTCACCACAGCC 2014-07-19 2014-07-19
snp_cf0065001014101 TM6 Y CGAGCTGCCCGGAGCCCCGTGGGACGGGTG GGCGTCCTCACAGAAGCAGTCACCACAGCC 2014-07-19 2014-07-19
snp_cf0043000867903 KM8 Y CGAGCTGCCCGGAGCCCCGTGGGACGGGTG GGCGTCCTCACAGAAGCAGTCACCACAGCC 2014-07-19 2014-07-19
snp_cf0037000884405 KM2 Y CGAGCTGCCCGGAGCCCCGTGGGACGGGTG GGCGTCCTCACAGAAGCAGTCACCACAGCC 2014-07-19 2014-07-19
snp_cf0076001075968 YJ7 Y CGAGCTGCCCGGAGCCCCGTGGGACGGGTG GGCGTCCTCACAGAAGCAGTCACCACAGCC 2014-07-19 2014-07-19
snp_cf0035001011398 KM10 Y CGAGCTGCCCGGAGCCCCGTGGGACGGGTG GGCGTCCTCACAGAAGCAGTCACCACAGCC 2014-07-19 2014-07-19
snp_cf0026000806520 GS2 Y CGAGCTGCCCGGAGCCCCGTGGGACGGGTG GGCGTCCTCACAGAAGCAGTCACCACAGCC 2014-07-19 2014-07-19
snp_cf0061001055722 TM2 C CGAGCTGCCCGGAGCCCCGTGGGACGGGTG GGCGTCCTCACAGAAGCAGTCACCACAGCC 2014-07-19 2014-07-19
snp_cf0014001026594 DQ6 Y CGAGCTGCCCGGAGCCCCGTGGGACGGGTG GGCGTCCTCACAGAAGCAGTCACCACAGCC 2014-07-19 2014-07-19
snp_cf0038000798804 KM3 Y CGAGCTGCCCGGAGCCCCGTGGGACGGGTG GGCGTCCTCACAGAAGCAGTCACCACAGCC 2014-07-19 2014-07-19
snp_cf0073001057389 YJ4 Y CGAGCTGCCCGGAGCCCCGTGGGACGGGTG GGCGTCCTCACAGAAGCAGTCACCACAGCC 2014-07-19 2014-07-19
snp_cf0006001210227 CRW C CGAGCTGCCCGGAGCCCCGTGGGACGGGTG GGCGTCCTCACAGAAGCAGTCACCACAGCC 2014-07-19 2014-07-19
snp_cf0078001065357 YJ9 Y CGAGCTGCCCGGAGCCCCGTGGGACGGGTG GGCGTCCTCACAGAAGCAGTCACCACAGCC 2014-07-19 2014-07-19
snp_cf0041001036964 KM6 Y CGAGCTGCCCGGAGCCCCGTGGGACGGGTG GGCGTCCTCACAGAAGCAGTCACCACAGCC 2014-07-19 2014-07-19
snp_cf0015001045612 DQ7 Y CGAGCTGCCCGGAGCCCCGTGGGACGGGTG GGCGTCCTCACAGAAGCAGTCACCACAGCC 2014-07-19 2014-07-19
snp_cf0077001053532 YJ8 Y CGAGCTGCCCGGAGCCCCGTGGGACGGGTG GGCGTCCTCACAGAAGCAGTCACCACAGCC 2014-07-19 2014-07-19
snp_cf0008001033031 DQ10 Y CGAGCTGCCCGGAGCCCCGTGGGACGGGTG GGCGTCCTCACAGAAGCAGTCACCACAGCC 2014-07-19 2014-07-19
snp_cf0011001055684 DQ3 Y CGAGCTGCCCGGAGCCCCGTGGGACGGGTG GGCGTCCTCACAGAAGCAGTCACCACAGCC 2014-07-19 2014-07-19
snp_cf0042001073515 KM7 C CGAGCTGCCCGGAGCCCCGTGGGACGGGTG GGCGTCCTCACAGAAGCAGTCACCACAGCC 2014-07-19 2014-07-19
snp_cf0064001051612 TM5 Y CGAGCTGCCCGGAGCCCCGTGGGACGGGTG GGCGTCCTCACAGAAGCAGTCACCACAGCC 2014-07-19 2014-07-19
snp_cf0020001032320 FAMBTIM00001 Y CGAGCTGCCCGGAGCCCCGTGGGACGGGTG GGCGTCCTCACAGAAGCAGTCACCACAGCC 2014-07-19 2014-07-19
snp_cf0024000845850 GS10 Y CGAGCTGCCCGGAGCCCCGTGGGACGGGTG GGCGTCCTCACAGAAGCAGTCACCACAGCC 2014-07-19 2014-07-19
snp_cf0010001043240 DQ2 Y CGAGCTGCCCGGAGCCCCGTGGGACGGGTG GGCGTCCTCACAGAAGCAGTCACCACAGCC 2014-07-19 2014-07-19
snp_cf0021000986648 FAMICHN00001 Y CGAGCTGCCCGGAGCCCCGTGGGACGGGTG GGCGTCCTCACAGAAGCAGTCACCACAGCC 2014-07-19 2014-07-19
snp_cf0068001005328 TM9 Y CGAGCTGCCCGGAGCCCCGTGGGACGGGTG GGCGTCCTCACAGAAGCAGTCACCACAGCC 2014-07-19 2014-07-19
snp_cf0074001060509 YJ5 Y CGAGCTGCCCGGAGCCCCGTGGGACGGGTG GGCGTCCTCACAGAAGCAGTCACCACAGCC 2014-07-19 2014-07-19
snp_cf0040000920962 KM5 Y CGAGCTGCCCGGAGCCCCGTGGGACGGGTG GGCGTCCTCACAGAAGCAGTCACCACAGCC 2014-07-19 2014-07-19
snp_cf0004000866337 Basenji C CGAGCTGCCCGGAGCCCCGTGGGACGGGTG GGCGTCCTCACAGAAGCAGTCACCACAGCC 2014-07-19 2014-07-19
snp_cf0071001064987 YJ2 C CGAGCTGCCCGGAGCCCCGTGGGACGGGTG GGCGTCCTCACAGAAGCAGTCACCACAGCC 2014-07-19 2014-07-19
snp_cf0062001045421 TM3 Y CGAGCTGCCCGGAGCCCCGTGGGACGGGTG GGCGTCCTCACAGAAGCAGTCACCACAGCC 2014-07-19 2014-07-19
snp_cf0030000829912 GS6 Y CGAGCTGCCCGGAGCCCCGTGGGACGGGTG GGCGTCCTCACAGAAGCAGTCACCACAGCC 2014-07-19 2014-07-19
snp_cf0017001057870 DQ9 Y CGAGCTGCCCGGAGCCCCGTGGGACGGGTG GGCGTCCTCACAGAAGCAGTCACCACAGCC 2014-07-19 2014-07-19
snp_cf0044000923246 KM9 Y CGAGCTGCCCGGAGCCCCGTGGGACGGGTG GGCGTCCTCACAGAAGCAGTCACCACAGCC 2014-07-19 2014-07-19
snp_cf0075001070669 YJ6 Y CGAGCTGCCCGGAGCCCCGTGGGACGGGTG GGCGTCCTCACAGAAGCAGTCACCACAGCC 2014-07-19 2014-07-19
snp_cf0012001047869 DQ4 Y CGAGCTGCCCGGAGCCCCGTGGGACGGGTG GGCGTCCTCACAGAAGCAGTCACCACAGCC 2014-07-19 2014-07-19
snp_cf0032000801411 GS8 Y CGAGCTGCCCGGAGCCCCGTGGGACGGGTG GGCGTCCTCACAGAAGCAGTCACCACAGCC 2014-07-19 2014-07-19
snp_cf0005001280046 CHW Y CGAGCTGCCCGGAGCCCCGTGGGACGGGTG GGCGTCCTCACAGAAGCAGTCACCACAGCC 2014-07-19 2014-07-19
snp_cf0027000808254 GS3 Y CGAGCTGCCCGGAGCCCCGTGGGACGGGTG GGCGTCCTCACAGAAGCAGTCACCACAGCC 2014-07-19 2014-07-19
snp_cf0066001064567 TM7 Y CGAGCTGCCCGGAGCCCCGTGGGACGGGTG GGCGTCCTCACAGAAGCAGTCACCACAGCC 2014-07-19 2014-07-19
snp_cf0028000768098 GS4 Y CGAGCTGCCCGGAGCCCCGTGGGACGGGTG GGCGTCCTCACAGAAGCAGTCACCACAGCC 2014-07-19 2014-07-19
snp_cf0013001008628 DQ5 Y CGAGCTGCCCGGAGCCCCGTGGGACGGGTG GGCGTCCTCACAGAAGCAGTCACCACAGCC 2014-07-19 2014-07-19
snp_cf0072001071608 YJ3 Y CGAGCTGCCCGGAGCCCCGTGGGACGGGTG GGCGTCCTCACAGAAGCAGTCACCACAGCC 2014-07-19 2014-07-19
snp_cf0063001028083 TM4 Y CGAGCTGCCCGGAGCCCCGTGGGACGGGTG GGCGTCCTCACAGAAGCAGTCACCACAGCC 2014-07-19 2014-07-19
snp_cf0070001099340 YJ1 C CGAGCTGCCCGGAGCCCCGTGGGACGGGTG GGCGTCCTCACAGAAGCAGTCACCACAGCC 2014-07-19 2014-07-19
snp_cf0067001009292 TM8 Y CGAGCTGCCCGGAGCCCCGTGGGACGGGTG GGCGTCCTCACAGAAGCAGTCACCACAGCC 2014-07-19 2014-07-19
snp_cf0049001050492 LJ4 Y CGAGCTGCCCGGAGCCCCGTGGGACGGGTG GGCGTCCTCACAGAAGCAGTCACCACAGCC 2014-07-19 2014-07-19
snp_cf0025000803105 GS1 Y CGAGCTGCCCGGAGCCCCGTGGGACGGGTG GGCGTCCTCACAGAAGCAGTCACCACAGCC 2014-07-19 2014-07-19
snp_cf0056001322973 LUPWRUS00001 Y CGAGCTGCCCGGAGCCCCGTGGGACGGGTG GGCGTCCTCACAGAAGCAGTCACCACAGCC 2014-07-19 2014-07-19
6.Fasta Information
CAGCGCACCA TCCACGGCGG CGAGCTGCCC GGAGCCCCGT GGGACGGGTG
Y
GGCGTCCTCA CAGAAGCAGT CACCACAGCC CCGGGTGCAG CCAGGACCGT