e.g. 1:1246..9423
SNP Detail For snp_cf0033000811361    [See in GBrowse]
1.General Information
SNP ID: snp_cf0033000811361
Organism: Canis familiaris
Individual: GS9
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: R
5'flank: AAGGGGCTGATGCTTGAGCTCATCCTACTC
3'flank: TATCCGAAGTCTTGGAGGCCTCGGACTGGG
3.Reference Map information
Chrom Position Reference GS9
Chr16 160563 A R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000014734 36838 + A CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000042831 3826 ATA => GTA ENSCAFP00000040839 1276 I => V
+ ENSCAFT00000023399 3292 ATA => GTA ENSCAFP00000021730 1098 I => V
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0063001028125 TM4 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0006001210264 CRW R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0052001017803 LJ7 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0029000749458 GS5 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0069001076169 YJ10 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0009001051917 DQ1 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0039000836355 KM4 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0076001076012 YJ7 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0050000964183 LJ5 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0059001051934 TM10 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0065001014148 TM6 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0055001308905 LUPWCHN00001 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0057001260916 LUPWRUS00002 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0037000884449 KM2 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0066001064613 TM7 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0060001035852 TM1 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0007000883892 Dingo R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0017001057912 DQ9 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0043000867948 KM8 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0031000820310 GS7 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0026000806563 GS2 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0054000943003 LJ9 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0018000867977 FAMBBEM00001 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0051001043597 LJ6 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0058001306984 LUPWRUS00003 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0040000921004 KM5 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0001000434781 solidGW1 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-08-01 2014-08-01
snp_cf0061001055764 TM2 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0038000798846 KM3 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0015001045652 DQ7 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0035001011440 KM10 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0074001060556 YJ5 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0071001065029 YJ2 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0077001053577 YJ8 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0008001033073 DQ10 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0042001073560 KM7 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0046000965673 LJ1 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0064001051655 TM5 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0020001032362 FAMBTIM00001 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0045000945572 LJ10 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0075001070715 YJ6 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0010001043283 DQ2 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0012001047910 DQ4 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0011001055726 DQ3 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0021000986688 FAMICHN00001 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0068001005371 TM9 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0024000845892 GS10 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0014001026636 DQ6 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0028000768140 GS4 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0072001071651 YJ3 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0023000992163 FAMICHN00003 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0053001016227 LJ8 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0056001323015 LUPWRUS00001 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0041001037007 KM6 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0078001065404 YJ9 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0062001045466 TM3 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0004000866374 Basenji R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0034001232119 ISW G AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0073001057435 YJ4 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0030000829953 GS6 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0044000923288 KM9 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0016001038640 DQ8 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0019000807462 FAMBGSD00001 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0022000931610 FAMICHN00002 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0036000825358 KM1 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0013001008672 DQ5 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0032000801449 GS8 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0067001009335 TM8 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0049001050535 LJ4 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0027000808297 GS3 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0005001280084 CHW R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0002000678219 CID1 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-08-02 2014-08-02
snp_cf0070001099386 YJ1 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0047001007450 LJ2 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
snp_cf0025000803148 GS1 R AAGGGGCTGATGCTTGAGCTCATCCTACTC TATCCGAAGTCTTGGAGGCCTCGGACTGGG 2014-07-19 2014-07-19
6.Fasta Information
CGGGGAGGCT GGCGGTGGAC AAGGGGCTGA TGCTTGAGCT CATCCTACTC
R
TATCCGAAGT CTTGGAGGCC TCGGACTGGG AGAAACCCAG AAATTCGGGC