e.g. 1:1246..9423
SNP Detail For snp_cf0033000811374    [See in GBrowse]
1.General Information
SNP ID: snp_cf0033000811374
Organism: Canis familiaris
Individual: GS9
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: TCTTCAAGAAGAACCTGTATCCGTGGGGAC
3'flank: AGGTCCTGGGCAGGTACGAAATGGCAGGTG
3.Reference Map information
Chrom Position Reference GS9
Chr16 162056 A G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000014734 38331 + A CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000042831 4148 CAA => CGA ENSCAFP00000040839 1383 Q => R
+ ENSCAFT00000023399 3584 CAA => CGA ENSCAFP00000021730 1195 Q => R
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0023000992177 FAMICHN00003 R TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0054000943013 LJ9 R TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0026000806576 GS2 G TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0021000986702 FAMICHN00001 R TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0034001232135 ISW G TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0038000798859 KM3 G TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0053001016241 LJ8 R TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0024000845905 GS10 R TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0062001045480 TM3 R TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0049001050548 LJ4 R TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0041001037020 KM6 R TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0042001073573 KM7 R TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0074001060569 YJ5 R TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0047001007463 LJ2 G TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0015001045665 DQ7 R TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0008001033087 DQ10 G TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0070001099401 YJ1 G TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0036000825371 KM1 G TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0006001210277 CRW G TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0076001076024 YJ7 R TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0064001051668 TM5 G TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0075001070728 YJ6 R TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0039000836369 KM4 G TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0052001017816 LJ7 R TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0044000923302 KM9 R TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0020001032376 FAMBTIM00001 G TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0066001064627 TM7 R TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0012001047923 DQ4 G TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0037000884462 KM2 R TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0027000808310 GS3 R TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0063001028139 TM4 G TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0072001071665 YJ3 G TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0059001051948 TM10 R TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0004000866387 Basenji R TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0011001055739 DQ3 G TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0017001057925 DQ9 R TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0025000803161 GS1 R TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0028000768153 GS4 R TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0065001014162 TM6 R TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0067001009350 TM8 R TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0030000829966 GS6 G TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0069001076183 YJ10 G TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0031000820323 GS7 G TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0019000807476 FAMBGSD00001 G TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0016001038653 DQ8 G TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0007000883905 Dingo G TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0001000434789 solidGW1 G TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-08-01 2014-08-01
snp_cf0022000931623 FAMICHN00002 G TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0061001055777 TM2 R TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0013001008685 DQ5 G TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0009001051930 DQ1 R TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0005001280096 CHW G TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0032000801460 GS8 R TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0040000921018 KM5 G TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0002000678227 CID1 R TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-08-02 2014-08-02
snp_cf0035001011453 KM10 R TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0029000749471 GS5 G TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0078001065419 YJ9 R TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0018000867991 FAMBBEM00001 R TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0048000994997 LJ3 R TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0071001065044 YJ2 G TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0045000945585 LJ10 G TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0051001043610 LJ6 R TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0068001005386 TM9 R TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0043000867961 KM8 R TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0010001043296 DQ2 G TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0050000964195 LJ5 G TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0058001306998 LUPWRUS00003 R TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0057001260929 LUPWRUS00002 R TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0077001053590 YJ8 R TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0060001035865 TM1 G TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0073001057448 YJ4 R TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0014001026649 DQ6 G TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0055001308918 LUPWCHN00001 G TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
snp_cf0056001323029 LUPWRUS00001 R TCTTCAAGAAGAACCTGTATCCGTGGGGAC AGGTCCTGGGCAGGTACGAAATGGCAGGTG 2014-07-19 2014-07-19
6.Fasta Information
CTACATTAGC CAGCTCATGC TCTTCAAGAA GAACCTGTAT CCGTGGGGAC
G
AGGTCCTGGG CAGGTACGAA ATGGCAGGTG ACCGGTCCCT TCCCACGACC