e.g. 1:1246..9423
SNP Detail For snp_cf0033000811423    [See in GBrowse]
1.General Information
SNP ID: snp_cf0033000811423
Organism: Canis familiaris
Individual: GS9
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs8663451  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: AATGCCACTTTCTCAGCGAGTGACATTTCC
3'flank: AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG
3.Reference Map information
Chrom Position Reference GS9
Chr16 167560 A G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000014734 43835 + A CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000042831 4795 AAG => GAG ENSCAFP00000040839 1599 K => E
+ ENSCAFT00000023399 4231 AAG => GAG ENSCAFP00000021730 1411 K => E
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0064001051716 TM5 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0030000830014 GS6 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0011001055782 DQ3 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0021000986749 FAMICHN00001 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0001000434808 solidGW1 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-08-01 2014-08-01
snp_cf0022000931643 FAMICHN00002 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0004000866427 Basenji G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0010001043341 DQ2 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0075001070774 YJ6 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0053001016286 LJ8 R AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0073001057491 YJ4 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0028000768200 GS4 R AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0041001037065 KM6 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0034001232175 ISW G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0015001045707 DQ7 R AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0050000964215 LJ5 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0078001065465 YJ9 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0062001045524 TM3 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0070001099451 YJ1 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0016001038702 DQ8 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0048000995022 LJ3 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0072001071714 YJ3 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0044000923344 KM9 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0052001017859 LJ7 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0023000992222 FAMICHN00003 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0002000678243 CID1 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-08-02 2014-08-02
snp_cf0027000808358 GS3 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0012001047967 DQ4 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0032000801505 GS8 R AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0068001005440 TM9 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0036000825416 KM1 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0018000868029 FAMBBEM00001 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0020001032419 FAMBTIM00001 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0024000845954 GS10 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0025000803208 GS1 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0019000807523 FAMBGSD00001 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0013001008729 DQ5 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0063001028185 TM4 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0017001057967 DQ9 R AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0049001050595 LJ4 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0054000943031 LJ9 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0039000836419 KM4 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0058001307041 LUPWRUS00003 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0059001051992 TM10 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0007000883948 Dingo G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0076001076073 YJ7 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0009001051971 DQ1 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0029000749514 GS5 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0066001064674 TM7 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0031000820370 GS7 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0035001011496 KM10 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0003000583781 dbSNP139 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0005001280138 CHW G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0006001210313 CRW G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0069001076232 YJ10 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0071001065089 YJ2 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0056001323074 LUPWRUS00001 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0026000806625 GS2 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0061001055823 TM2 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0060001035908 TM1 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0065001014211 TM6 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0051001043650 LJ6 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0067001009403 TM8 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0037000884511 KM2 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0040000921067 KM5 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0074001060617 YJ5 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0014001026689 DQ6 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0047001007492 LJ2 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0055001308958 LUPWCHN00001 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0043000868007 KM8 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0057001260969 LUPWRUS00002 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0042001073620 KM7 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0077001053636 YJ8 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0038000798907 KM3 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0008001033130 DQ10 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
snp_cf0045000945613 LJ10 G AATGCCACTTTCTCAGCGAGTGACATTTCC AGCTGCAGAGGTGAGCTCCGTTTTCTGGAG 2014-07-19 2014-07-19
6.Fasta Information
CCATCTCGAG AAGAAGCCCG AATGCCACTT TCTCAGCGAG TGACATTTCC
G
AGCTGCAGAG GTGAGCTCCG TTTTCTGGAG AACAGTAAGT TTTACTTGCG