e.g. 1:1246..9423
SNP Detail For snp_cf0033000811434    [See in GBrowse]
1.General Information
SNP ID: snp_cf0033000811434
Organism: Canis familiaris
Individual: GS9
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs8663459  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: Y
5'flank: GGTTACATTTTTCTGCAAGAAGATGCTCCA
3'flank: CCGGCCACCAGCTGTACGCGGTTGTCGTGG
3.Reference Map information
Chrom Position Reference GS9
Chr16 169454 C Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000014734 45729 + C CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000042831 4945 CCC => TCC ENSCAFP00000040839 1649 P => S
+ ENSCAFT00000023399 4381 CCC => TCC ENSCAFP00000021730 1461 P => S
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0044000923351 KM9 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0069001076243 YJ10 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0056001323084 LUPWRUS00001 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0071001065098 YJ2 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0019000807531 FAMBGSD00001 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0012001047978 DQ4 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0065001014220 TM6 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0053001016293 LJ8 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0022000931649 FAMICHN00002 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0032000801512 GS8 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0039000836430 KM4 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0036000825426 KM1 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0027000808368 GS3 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0020001032428 FAMBTIM00001 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0061001055830 TM2 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0014001026699 DQ6 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0013001008738 DQ5 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0004000866435 Basenji T GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0073001057498 YJ4 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0002000678249 CID1 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-08-02 2014-08-02
snp_cf0025000803214 GS1 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0048000995027 LJ3 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0030000830025 GS6 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0007000883958 Dingo Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0001000434815 solidGW1 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-08-01 2014-08-01
snp_cf0024000845964 GS10 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0010001043350 DQ2 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0005001280144 CHW Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0034001232186 ISW Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0078001065473 YJ9 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0023000992230 FAMICHN00003 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0062001045532 TM3 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0052001017866 LJ7 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0060001035916 TM1 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0054000943034 LJ9 T GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0008001033138 DQ10 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0057001260975 LUPWRUS00002 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0026000806635 GS2 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0059001051999 TM10 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0068001005449 TM9 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0038000798916 KM3 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0043000868017 KM8 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0076001076081 YJ7 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0049001050605 LJ4 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0003000583786 dbSNP139 T GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0063001028193 TM4 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0077001053645 YJ8 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0042001073630 KM7 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0074001060625 YJ5 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0017001057974 DQ9 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0011001055793 DQ3 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0058001307051 LUPWRUS00003 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0064001051726 TM5 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0046000965722 LJ1 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0029000749523 GS5 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0009001051981 DQ1 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0055001308963 LUPWCHN00001 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0040000921077 KM5 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0021000986757 FAMICHN00001 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0037000884521 KM2 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0067001009412 TM8 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0028000768210 GS4 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0050000964220 LJ5 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0015001045715 DQ7 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0035001011502 KM10 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0075001070782 YJ6 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0051001043659 LJ6 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0041001037074 KM6 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0018000868040 FAMBBEM00001 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0070001099461 YJ1 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0045000945618 LJ10 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0016001038712 DQ8 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0031000820380 GS7 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0047001007499 LJ2 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0072001071724 YJ3 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
snp_cf0066001064682 TM7 Y GGTTACATTTTTCTGCAAGAAGATGCTCCA CCGGCCACCAGCTGTACGCGGTTGTCGTGG 2014-07-19 2014-07-19
6.Fasta Information
GTCATGAGAG AAAGAAAGCC GGTTACATTT TTCTGCAAGA AGATGCTCCA
Y
CCGGCCACCA GCTGTACGCG GTTGTCGTGG ACACAGGCTT CCGCTCTCCC