e.g. 1:1246..9423
SNP Detail For snp_cf0034000448024    [See in GBrowse]
1.General Information
SNP ID: snp_cf0034000448024
Organism: Canis familiaris
Individual: ISW
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: M
5'flank: AATCATCTTACTGCTGAGAGTTGAGCTCAC
3'flank: CTCAGTCCCTCACAGTTCCACACTGCCTGC
3.Reference Map information
Chrom Position Reference ISW
Chr11 549 C M
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0010000370346 DQ2 M AATCATCTTACTGCTGAGAGTTGAGCTCAC CTCAGTCCCTCACAGTTCCACACTGCCTGC 2014-07-19 2014-07-19
snp_cf0045000308563 LJ10 M AATCATCTTACTGCTGAGAGTTGAGCTCAC CTCAGTCCCTCACAGTTCCACACTGCCTGC 2014-07-19 2014-07-19
snp_cf0075000382491 YJ6 M AATCATCTTACTGCTGAGAGTTGAGCTCAC CTCAGTCCCTCACAGTTCCACACTGCCTGC 2014-07-19 2014-07-19
snp_cf0056000474768 LUPWRUS00001 M AATCATCTTACTGCTGAGAGTTGAGCTCAC CTCAGTCCCTCACAGTTCCACACTGCCTGC 2014-07-19 2014-07-19
snp_cf0057000456757 LUPWRUS00002 A AATCATCTTACTGCTGAGAGTTGAGCTCAC CTCAGTCCCTCACAGTTCCACACTGCCTGC 2014-07-19 2014-07-19
snp_cf0073000381197 YJ4 M AATCATCTTACTGCTGAGAGTTGAGCTCAC CTCAGTCCCTCACAGTTCCACACTGCCTGC 2014-07-19 2014-07-19
snp_cf0058000470023 LUPWRUS00003 M AATCATCTTACTGCTGAGAGTTGAGCTCAC CTCAGTCCCTCACAGTTCCACACTGCCTGC 2014-07-19 2014-07-19
snp_cf0012000362979 DQ4 M AATCATCTTACTGCTGAGAGTTGAGCTCAC CTCAGTCCCTCACAGTTCCACACTGCCTGC 2014-07-19 2014-07-19
snp_cf0006000426733 CRW A AATCATCTTACTGCTGAGAGTTGAGCTCAC CTCAGTCCCTCACAGTTCCACACTGCCTGC 2014-07-19 2014-07-19
snp_cf0051000364705 LJ6 M AATCATCTTACTGCTGAGAGTTGAGCTCAC CTCAGTCCCTCACAGTTCCACACTGCCTGC 2014-07-19 2014-07-19
snp_cf0060000375562 TM1 M AATCATCTTACTGCTGAGAGTTGAGCTCAC CTCAGTCCCTCACAGTTCCACACTGCCTGC 2014-07-19 2014-07-19
6.Fasta Information
TAGCTGAACG CCTTGTCCAA AATCATCTTA CTGCTGAGAG TTGAGCTCAC
M
CTCAGTCCCT CACAGTTCCA CACTGCCTGC AGAATGCGTT TCCAACATCT