e.g. 1:1246..9423
SNP Detail For snp_cf0034000448026    [See in GBrowse]
1.General Information
SNP ID: snp_cf0034000448026
Organism: Canis familiaris
Individual: ISW
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: R
5'flank: GCTTCGCTTCCAAAGGATTTCTTTCGATAC
3'flank: GGATGCAAGTTTTGTGAGCAGCAAGTGACT
3.Reference Map information
Chrom Position Reference ISW
Chr11 1469 G R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0075000382493 YJ6 R GCTTCGCTTCCAAAGGATTTCTTTCGATAC GGATGCAAGTTTTGTGAGCAGCAAGTGACT 2014-07-19 2014-07-19
snp_cf0010000370348 DQ2 R GCTTCGCTTCCAAAGGATTTCTTTCGATAC GGATGCAAGTTTTGTGAGCAGCAAGTGACT 2014-07-19 2014-07-19
snp_cf0012000362981 DQ4 R GCTTCGCTTCCAAAGGATTTCTTTCGATAC GGATGCAAGTTTTGTGAGCAGCAAGTGACT 2014-07-19 2014-07-19
snp_cf0045000308566 LJ10 R GCTTCGCTTCCAAAGGATTTCTTTCGATAC GGATGCAAGTTTTGTGAGCAGCAAGTGACT 2014-07-19 2014-07-19
snp_cf0051000364707 LJ6 R GCTTCGCTTCCAAAGGATTTCTTTCGATAC GGATGCAAGTTTTGTGAGCAGCAAGTGACT 2014-07-19 2014-07-19
snp_cf0060000375564 TM1 R GCTTCGCTTCCAAAGGATTTCTTTCGATAC GGATGCAAGTTTTGTGAGCAGCAAGTGACT 2014-07-19 2014-07-19
snp_cf0073000381199 YJ4 R GCTTCGCTTCCAAAGGATTTCTTTCGATAC GGATGCAAGTTTTGTGAGCAGCAAGTGACT 2014-07-19 2014-07-19
6.Fasta Information
CACATGCTGA CAGCCTGTAC GCTTCGCTTC CAAAGGATTT CTTTCGATAC
R
GGATGCAAGT TTTGTGAGCA GCAAGTGACT CTTAGCTCCA TCCAGCAACT