e.g. 1:1246..9423
SNP Detail For snp_cf0034000448027    [See in GBrowse]
1.General Information
SNP ID: snp_cf0034000448027
Organism: Canis familiaris
Individual: ISW
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: Y
5'flank: GGCCAGGAGAACGCAGCTAGTGGAAAGGGG
3'flank: CTTCGAGGCATGCTTCCTTTTGAGAGGTGA
3.Reference Map information
Chrom Position Reference ISW
Chr11 1822 C Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0075000382494 YJ6 Y GGCCAGGAGAACGCAGCTAGTGGAAAGGGG CTTCGAGGCATGCTTCCTTTTGAGAGGTGA 2014-07-19 2014-07-19
snp_cf0012000362983 DQ4 Y GGCCAGGAGAACGCAGCTAGTGGAAAGGGG CTTCGAGGCATGCTTCCTTTTGAGAGGTGA 2014-07-19 2014-07-19
snp_cf0045000308567 LJ10 Y GGCCAGGAGAACGCAGCTAGTGGAAAGGGG CTTCGAGGCATGCTTCCTTTTGAGAGGTGA 2014-07-19 2014-07-19
snp_cf0060000375565 TM1 Y GGCCAGGAGAACGCAGCTAGTGGAAAGGGG CTTCGAGGCATGCTTCCTTTTGAGAGGTGA 2014-07-19 2014-07-19
snp_cf0051000364709 LJ6 Y GGCCAGGAGAACGCAGCTAGTGGAAAGGGG CTTCGAGGCATGCTTCCTTTTGAGAGGTGA 2014-07-19 2014-07-19
snp_cf0010000370349 DQ2 Y GGCCAGGAGAACGCAGCTAGTGGAAAGGGG CTTCGAGGCATGCTTCCTTTTGAGAGGTGA 2014-07-19 2014-07-19
snp_cf0073000381200 YJ4 Y GGCCAGGAGAACGCAGCTAGTGGAAAGGGG CTTCGAGGCATGCTTCCTTTTGAGAGGTGA 2014-07-19 2014-07-19
6.Fasta Information
CAATGTAGCT TCGTTCTCAC GGCCAGGAGA ACGCAGCTAG TGGAAAGGGG
Y
CTTCGAGGCA TGCTTCCTTT TGAGAGGTGA GCTCAAGACA GGACCCTCCG