e.g. 1:1246..9423
SNP Detail For snp_cf0034000448028    [See in GBrowse]
1.General Information
SNP ID: snp_cf0034000448028
Organism: Canis familiaris
Individual: ISW
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: CGTCTCCAGGTGCAGTAGAGCAGTATTGAC
3'flank: GAACGTCCTGACTTAAAATGCTGTTACCTT
3.Reference Map information
Chrom Position Reference ISW
Chr11 3538 A G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0056000474775 LUPWRUS00001 R CGTCTCCAGGTGCAGTAGAGCAGTATTGAC GAACGTCCTGACTTAAAATGCTGTTACCTT 2014-07-19 2014-07-19
snp_cf0010000370350 DQ2 R CGTCTCCAGGTGCAGTAGAGCAGTATTGAC GAACGTCCTGACTTAAAATGCTGTTACCTT 2014-07-19 2014-07-19
snp_cf0060000375566 TM1 R CGTCTCCAGGTGCAGTAGAGCAGTATTGAC GAACGTCCTGACTTAAAATGCTGTTACCTT 2014-07-19 2014-07-19
snp_cf0075000382495 YJ6 R CGTCTCCAGGTGCAGTAGAGCAGTATTGAC GAACGTCCTGACTTAAAATGCTGTTACCTT 2014-07-19 2014-07-19
snp_cf0006000426735 CRW G CGTCTCCAGGTGCAGTAGAGCAGTATTGAC GAACGTCCTGACTTAAAATGCTGTTACCTT 2014-07-19 2014-07-19
snp_cf0051000364711 LJ6 R CGTCTCCAGGTGCAGTAGAGCAGTATTGAC GAACGTCCTGACTTAAAATGCTGTTACCTT 2014-07-19 2014-07-19
snp_cf0062000372693 TM3 R CGTCTCCAGGTGCAGTAGAGCAGTATTGAC GAACGTCCTGACTTAAAATGCTGTTACCTT 2014-07-19 2014-07-19
snp_cf0045000308568 LJ10 R CGTCTCCAGGTGCAGTAGAGCAGTATTGAC GAACGTCCTGACTTAAAATGCTGTTACCTT 2014-07-19 2014-07-19
snp_cf0057000456767 LUPWRUS00002 G CGTCTCCAGGTGCAGTAGAGCAGTATTGAC GAACGTCCTGACTTAAAATGCTGTTACCTT 2014-07-19 2014-07-19
snp_cf0058000470025 LUPWRUS00003 R CGTCTCCAGGTGCAGTAGAGCAGTATTGAC GAACGTCCTGACTTAAAATGCTGTTACCTT 2014-07-19 2014-07-19
snp_cf0012000362984 DQ4 R CGTCTCCAGGTGCAGTAGAGCAGTATTGAC GAACGTCCTGACTTAAAATGCTGTTACCTT 2014-07-19 2014-07-19
snp_cf0005000443114 CHW R CGTCTCCAGGTGCAGTAGAGCAGTATTGAC GAACGTCCTGACTTAAAATGCTGTTACCTT 2014-07-19 2014-07-19
snp_cf0073000381201 YJ4 R CGTCTCCAGGTGCAGTAGAGCAGTATTGAC GAACGTCCTGACTTAAAATGCTGTTACCTT 2014-07-19 2014-07-19
6.Fasta Information
GTTGCAGGCT TCAATGGTTG CGTCTCCAGG TGCAGTAGAG CAGTATTGAC
G
GAACGTCCTG ACTTAAAATG CTGTTACCTT CTCACGGCCA TAACAACTCA