e.g. 1:1246..9423
SNP Detail For snp_cf0034000448030    [See in GBrowse]
1.General Information
SNP ID: snp_cf0034000448030
Organism: Canis familiaris
Individual: ISW
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: TCCGGTGTTGGTATCTCCACACATACACAC
3'flank: TACACCCAGTCACCTGGCCGATATCGATGG
3.Reference Map information
Chrom Position Reference ISW
Chr11 9508 A G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0062000372719 TM3 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0005000443137 CHW G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0048000345079 LJ3 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0064000377952 TM5 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0055000469586 LUPWCHN00001 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0029000237350 GS5 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0018000304537 FAMBBEM00001 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0014000359591 DQ6 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0075000382498 YJ6 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0063000370311 TM4 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0004000302175 Basenji G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0028000272194 GS4 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0023000339810 FAMICHN00003 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0017000381033 DQ9 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0045000308570 LJ10 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0041000347156 KM6 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0036000298291 KM1 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0073000381203 YJ4 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0011000372519 DQ3 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0032000273736 GS8 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0072000381473 YJ3 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0013000375233 DQ5 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0070000389748 YJ1 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0027000284344 GS3 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0076000379628 YJ7 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0059000373896 TM10 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0015000370566 DQ7 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0026000286286 GS2 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0074000375336 YJ5 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0049000374919 LJ4 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0039000287726 KM4 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0038000293637 KM3 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0010000370355 DQ2 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0024000312535 GS10 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0054000327988 LJ9 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0057000456790 LUPWRUS00002 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0077000374950 YJ8 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0030000291546 GS6 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0033000302133 GS9 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0042000358646 KM7 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0037000314053 KM2 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0022000337010 FAMICHN00002 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0007000301940 Dingo G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0058000470029 LUPWRUS00003 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0052000354934 LJ7 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0035000348828 KM10 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0019000286889 FAMBGSD00001 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0065000350940 TM6 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0046000335931 LJ1 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0068000355959 TM9 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0060000375570 TM1 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0053000362226 LJ8 R TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0031000293574 GS7 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0009000370034 DQ1 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0071000374405 YJ2 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0061000374374 TM2 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0043000314830 KM8 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0025000271286 GS1 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0067000362849 TM8 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0078000380686 YJ9 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0069000380625 YJ10 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0020000366318 FAMBTIM00001 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0001000194003 solidGW1 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-08-01 2014-08-01
snp_cf0051000364714 LJ6 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0056000474794 LUPWRUS00001 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0050000330353 LJ5 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0066000375905 TM7 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0006000426737 CRW G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0021000352335 FAMICHN00001 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0044000324926 KM9 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0047000342319 LJ2 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0008000362441 DQ10 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0040000309798 KM5 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0012000362988 DQ4 G TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
snp_cf0016000371082 DQ8 R TCCGGTGTTGGTATCTCCACACATACACAC TACACCCAGTCACCTGGCCGATATCGATGG 2014-07-19 2014-07-19
6.Fasta Information
CTTCCAGCGA GGTTGAAGTG TCCGGTGTTG GTATCTCCAC ACATACACAC
G
TACACCCAGT CACCTGGCCG ATATCGATGG GGATCCAGGG GTGGCCCAGT