e.g. 1:1246..9423
SNP Detail For snp_cf0034000448031    [See in GBrowse]
1.General Information
SNP ID: snp_cf0034000448031
Organism: Canis familiaris
Individual: ISW
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: ACCACATCCTCCTTACATATGAGGATGCTC
3'flank: TCCTCCATACAGATGAGGACCTCCATCCTC
3.Reference Map information
Chrom Position Reference ISW
Chr11 12236 A G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0064000377953 TM5 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0026000286287 GS2 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0008000362444 DQ10 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0018000304538 FAMBBEM00001 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0029000237351 GS5 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0014000359592 DQ6 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0063000370312 TM4 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0028000272195 GS4 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0049000374920 LJ4 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0004000302176 Basenji G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0023000339811 FAMICHN00003 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0057000456801 LUPWRUS00002 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0045000308572 LJ10 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0009000370035 DQ1 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0041000347157 KM6 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0011000372520 DQ3 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0017000381034 DQ9 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0067000362850 TM8 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0073000381205 YJ4 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0005000443148 CHW G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0036000298292 KM1 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0032000273737 GS8 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0072000381474 YJ3 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0013000375234 DQ5 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0070000389749 YJ1 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0076000379629 YJ7 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0075000382500 YJ6 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0027000284345 GS3 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0033000302134 GS9 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0015000370567 DQ7 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0059000373897 TM10 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0055000469587 LUPWCHN00001 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0074000375338 YJ5 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0058000470030 LUPWRUS00003 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0010000370356 DQ2 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0056000474803 LUPWRUS00001 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0077000374951 YJ8 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0024000312536 GS10 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0038000293638 KM3 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0019000286890 FAMBGSD00001 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0030000291547 GS6 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0039000287727 KM4 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0002000239956 CID1 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-08-02 2014-08-02
snp_cf0022000337011 FAMICHN00002 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0047000342320 LJ2 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0007000301941 Dingo G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0052000354935 LJ7 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0035000348829 KM10 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0046000335932 LJ1 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0065000350941 TM6 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0042000358647 KM7 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0037000314054 KM2 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0054000327990 LJ9 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0043000314831 KM8 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0060000375571 TM1 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0053000362227 LJ8 R ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0031000293575 GS7 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0061000374375 TM2 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0071000374406 YJ2 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0025000271287 GS1 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0020000366319 FAMBTIM00001 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0001000194008 solidGW1 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-08-01 2014-08-01
snp_cf0048000345082 LJ3 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0050000330354 LJ5 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0051000364716 LJ6 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0062000372728 TM3 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0066000375906 TM7 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0078000380688 YJ9 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0044000324927 KM9 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0006000426738 CRW G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0068000355960 TM9 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0021000352336 FAMICHN00001 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0069000380627 YJ10 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0016000371084 DQ8 R ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0040000309799 KM5 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
snp_cf0012000362989 DQ4 G ACCACATCCTCCTTACATATGAGGATGCTC TCCTCCATACAGATGAGGACCTCCATCCTC 2014-07-19 2014-07-19
6.Fasta Information
CGTCCTAATT ACGGATGAAG ACCACATCCT CCTTACATAT GAGGATGCTC
G
TCCTCCATAC AGATGAGGAC CTCCATCCTC CTTACAGATA GGACCTCCAT