e.g. 1:1246..9423
SNP Detail For snp_cf0034000448032    [See in GBrowse]
1.General Information
SNP ID: snp_cf0034000448032
Organism: Canis familiaris
Individual: ISW
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: R
5'flank: TAGACTGGTGCTACATACTAAGTTCCATAC
3'flank: TGAGAAGCTAGCTGAACCCCGTGTCCAAAG
3.Reference Map information
Chrom Position Reference ISW
Chr11 14265 A R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0056000474814 LUPWRUS00001 R TAGACTGGTGCTACATACTAAGTTCCATAC TGAGAAGCTAGCTGAACCCCGTGTCCAAAG 2014-07-19 2014-07-19
snp_cf0010000370359 DQ2 R TAGACTGGTGCTACATACTAAGTTCCATAC TGAGAAGCTAGCTGAACCCCGTGTCCAAAG 2014-07-19 2014-07-19
snp_cf0073000381207 YJ4 R TAGACTGGTGCTACATACTAAGTTCCATAC TGAGAAGCTAGCTGAACCCCGTGTCCAAAG 2014-07-19 2014-07-19
snp_cf0051000364719 LJ6 R TAGACTGGTGCTACATACTAAGTTCCATAC TGAGAAGCTAGCTGAACCCCGTGTCCAAAG 2014-07-19 2014-07-19
snp_cf0060000375574 TM1 R TAGACTGGTGCTACATACTAAGTTCCATAC TGAGAAGCTAGCTGAACCCCGTGTCCAAAG 2014-07-19 2014-07-19
snp_cf0062000372739 TM3 R TAGACTGGTGCTACATACTAAGTTCCATAC TGAGAAGCTAGCTGAACCCCGTGTCCAAAG 2014-07-19 2014-07-19
snp_cf0045000308576 LJ10 R TAGACTGGTGCTACATACTAAGTTCCATAC TGAGAAGCTAGCTGAACCCCGTGTCCAAAG 2014-07-19 2014-07-19
snp_cf0070000389751 YJ1 R TAGACTGGTGCTACATACTAAGTTCCATAC TGAGAAGCTAGCTGAACCCCGTGTCCAAAG 2014-07-19 2014-07-19
snp_cf0005000443160 CHW R TAGACTGGTGCTACATACTAAGTTCCATAC TGAGAAGCTAGCTGAACCCCGTGTCCAAAG 2014-07-19 2014-07-19
snp_cf0012000362992 DQ4 R TAGACTGGTGCTACATACTAAGTTCCATAC TGAGAAGCTAGCTGAACCCCGTGTCCAAAG 2014-07-19 2014-07-19
snp_cf0075000382503 YJ6 R TAGACTGGTGCTACATACTAAGTTCCATAC TGAGAAGCTAGCTGAACCCCGTGTCCAAAG 2014-07-19 2014-07-19
snp_cf0057000456814 LUPWRUS00002 G TAGACTGGTGCTACATACTAAGTTCCATAC TGAGAAGCTAGCTGAACCCCGTGTCCAAAG 2014-07-19 2014-07-19
6.Fasta Information
TTTCCTAGTA ATTCCTGTCT TAGACTGGTG CTACATACTA AGTTCCATAC
R
TGAGAAGCTA GCTGAACCCC GTGTCCAAAG GCAACTTACT TCTGAGAGTT