e.g. 1:1246..9423
SNP Detail For snp_cf0034000448033    [See in GBrowse]
1.General Information
SNP ID: snp_cf0034000448033
Organism: Canis familiaris
Individual: ISW
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: A
5'flank: GGAAGGGGGAAGGAGCTAGATAGGAAGACA
3'flank: GACGGGATGCGTGGAGGCCGAGAAAATTAA
3.Reference Map information
Chrom Position Reference ISW
Chr11 18092 C A
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0041000347161 KM6 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0064000377956 TM5 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0056000474825 LUPWRUS00001 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0020000366322 FAMBTIM00001 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0014000359594 DQ6 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0008000362447 DQ10 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0053000362230 LJ8 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0029000237353 GS5 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0069000380630 YJ10 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0067000362852 TM8 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0062000372750 TM3 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0063000370317 TM4 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0074000375341 YJ5 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0045000308579 LJ10 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0028000272197 GS4 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0049000374924 LJ4 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0011000372525 DQ3 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0023000339813 FAMICHN00003 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0026000286290 GS2 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0017000381035 DQ9 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0009000370038 DQ1 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0055000469591 LUPWCHN00001 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0018000304541 FAMBBEM00001 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0073000381209 YJ4 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0036000298294 KM1 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0039000287730 KM4 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0010000370360 DQ2 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0007000301944 Dingo A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0027000284348 GS3 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0013000375237 DQ5 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0038000293641 KM3 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0052000354940 LJ7 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0033000302138 GS9 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0075000382505 YJ6 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0072000381479 YJ3 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0004000302181 Basenji A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0058000470033 LUPWRUS00003 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0035000348834 KM10 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0059000373899 TM10 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0019000286893 FAMBGSD00001 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0076000379632 YJ7 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0078000380690 YJ9 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0077000374954 YJ8 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0024000312539 GS10 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0051000364721 LJ6 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0022000337014 FAMICHN00002 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0012000362993 DQ4 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0070000389754 YJ1 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0047000342324 LJ2 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0040000309802 KM5 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0044000324931 KM9 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0065000350943 TM6 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0015000370570 DQ7 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0046000335934 LJ1 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0057000456824 LUPWRUS00002 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0032000273740 GS8 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0054000327993 LJ9 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0037000314057 KM2 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0071000374408 YJ2 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0061000374379 TM2 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0048000345088 LJ3 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0031000293577 GS7 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0006000426741 CRW A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0050000330357 LJ5 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0060000375576 TM1 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0001000194009 solidGW1 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-08-01 2014-08-01
snp_cf0066000375909 TM7 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0043000314835 KM8 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0030000291550 GS6 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0025000271290 GS1 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0068000355963 TM9 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0021000352338 FAMICHN00001 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0042000358650 KM7 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0005000443171 CHW A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
snp_cf0016000371086 DQ8 A GGAAGGGGGAAGGAGCTAGATAGGAAGACA GACGGGATGCGTGGAGGCCGAGAAAATTAA 2014-07-19 2014-07-19
6.Fasta Information
TGCTCTCTTA GGAGCTCCGG GGAAGGGGGA AGGAGCTAGA TAGGAAGACA
A
GACGGGATGC GTGGAGGCCG AGAAAATTAA GGCCATTCCA CTTTTAGTCC