e.g. 1:1246..9423
SNP Detail For snp_cf0035003933625    [See in GBrowse]
1.General Information
SNP ID: snp_cf0035003933625
Organism: Canis familiaris
Individual: KM10
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: R
5'flank: ATCAGTGTGTAGCTAGGTTCCAACTGGCAT
3'flank: TACGAGTGGGTATCAGACATCTGCCTCCCA
3.Reference Map information
Chrom Position Reference KM10
Chr6 6953 A R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0057004803336 LUPWRUS00002 G ATCAGTGTGTAGCTAGGTTCCAACTGGCAT TACGAGTGGGTATCAGACATCTGCCTCCCA 2014-07-19 2014-07-19
snp_cf0018003363660 FAMBBEM00001 G ATCAGTGTGTAGCTAGGTTCCAACTGGCAT TACGAGTGGGTATCAGACATCTGCCTCCCA 2014-07-19 2014-07-19
snp_cf0009004049092 DQ1 R ATCAGTGTGTAGCTAGGTTCCAACTGGCAT TACGAGTGGGTATCAGACATCTGCCTCCCA 2014-07-19 2014-07-19
snp_cf0017004107244 DQ9 G ATCAGTGTGTAGCTAGGTTCCAACTGGCAT TACGAGTGGGTATCAGACATCTGCCTCCCA 2014-07-19 2014-07-19
snp_cf0030003155643 GS6 R ATCAGTGTGTAGCTAGGTTCCAACTGGCAT TACGAGTGGGTATCAGACATCTGCCTCCCA 2014-07-19 2014-07-19
snp_cf0063003978390 TM4 G ATCAGTGTGTAGCTAGGTTCCAACTGGCAT TACGAGTGGGTATCAGACATCTGCCTCCCA 2014-07-19 2014-07-19
snp_cf0026003185962 GS2 R ATCAGTGTGTAGCTAGGTTCCAACTGGCAT TACGAGTGGGTATCAGACATCTGCCTCCCA 2014-07-19 2014-07-19
snp_cf0072004163249 YJ3 G ATCAGTGTGTAGCTAGGTTCCAACTGGCAT TACGAGTGGGTATCAGACATCTGCCTCCCA 2014-07-19 2014-07-19
snp_cf0075004149843 YJ6 G ATCAGTGTGTAGCTAGGTTCCAACTGGCAT TACGAGTGGGTATCAGACATCTGCCTCCCA 2014-07-19 2014-07-19
snp_cf0031003200509 GS7 R ATCAGTGTGTAGCTAGGTTCCAACTGGCAT TACGAGTGGGTATCAGACATCTGCCTCCCA 2014-07-19 2014-07-19
snp_cf0028003053684 GS4 G ATCAGTGTGTAGCTAGGTTCCAACTGGCAT TACGAGTGGGTATCAGACATCTGCCTCCCA 2014-07-19 2014-07-19
snp_cf0045003705047 LJ10 G ATCAGTGTGTAGCTAGGTTCCAACTGGCAT TACGAGTGGGTATCAGACATCTGCCTCCCA 2014-07-19 2014-07-19
snp_cf0047003950324 LJ2 G ATCAGTGTGTAGCTAGGTTCCAACTGGCAT TACGAGTGGGTATCAGACATCTGCCTCCCA 2014-07-19 2014-07-19
snp_cf0065004038625 TM6 R ATCAGTGTGTAGCTAGGTTCCAACTGGCAT TACGAGTGGGTATCAGACATCTGCCTCCCA 2014-07-19 2014-07-19
snp_cf0061004111688 TM2 R ATCAGTGTGTAGCTAGGTTCCAACTGGCAT TACGAGTGGGTATCAGACATCTGCCTCCCA 2014-07-19 2014-07-19
snp_cf0029002989898 GS5 R ATCAGTGTGTAGCTAGGTTCCAACTGGCAT TACGAGTGGGTATCAGACATCTGCCTCCCA 2014-07-19 2014-07-19
snp_cf0070004292774 YJ1 G ATCAGTGTGTAGCTAGGTTCCAACTGGCAT TACGAGTGGGTATCAGACATCTGCCTCCCA 2014-07-19 2014-07-19
snp_cf0010004074969 DQ2 G ATCAGTGTGTAGCTAGGTTCCAACTGGCAT TACGAGTGGGTATCAGACATCTGCCTCCCA 2014-07-19 2014-07-19
snp_cf0007003435848 Dingo G ATCAGTGTGTAGCTAGGTTCCAACTGGCAT TACGAGTGGGTATCAGACATCTGCCTCCCA 2014-07-19 2014-07-19
snp_cf0039003414068 KM4 G ATCAGTGTGTAGCTAGGTTCCAACTGGCAT TACGAGTGGGTATCAGACATCTGCCTCCCA 2014-07-19 2014-07-19
snp_cf0064004087416 TM5 G ATCAGTGTGTAGCTAGGTTCCAACTGGCAT TACGAGTGGGTATCAGACATCTGCCTCCCA 2014-07-19 2014-07-19
snp_cf0058004995280 LUPWRUS00003 G ATCAGTGTGTAGCTAGGTTCCAACTGGCAT TACGAGTGGGTATCAGACATCTGCCTCCCA 2014-07-19 2014-07-19
snp_cf0041004032389 KM6 R ATCAGTGTGTAGCTAGGTTCCAACTGGCAT TACGAGTGGGTATCAGACATCTGCCTCCCA 2014-07-19 2014-07-19
snp_cf0043003414753 KM8 R ATCAGTGTGTAGCTAGGTTCCAACTGGCAT TACGAGTGGGTATCAGACATCTGCCTCCCA 2014-07-19 2014-07-19
snp_cf0013003986886 DQ5 G ATCAGTGTGTAGCTAGGTTCCAACTGGCAT TACGAGTGGGTATCAGACATCTGCCTCCCA 2014-07-19 2014-07-19
snp_cf0053003966628 LJ8 G ATCAGTGTGTAGCTAGGTTCCAACTGGCAT TACGAGTGGGTATCAGACATCTGCCTCCCA 2014-07-19 2014-07-19
snp_cf0033003173139 GS9 G ATCAGTGTGTAGCTAGGTTCCAACTGGCAT TACGAGTGGGTATCAGACATCTGCCTCCCA 2014-07-19 2014-07-19
snp_cf0024003182191 GS10 R ATCAGTGTGTAGCTAGGTTCCAACTGGCAT TACGAGTGGGTATCAGACATCTGCCTCCCA 2014-07-19 2014-07-19
snp_cf0044003571801 KM9 R ATCAGTGTGTAGCTAGGTTCCAACTGGCAT TACGAGTGGGTATCAGACATCTGCCTCCCA 2014-07-19 2014-07-19
snp_cf0002002700419 CID1 G ATCAGTGTGTAGCTAGGTTCCAACTGGCAT TACGAGTGGGTATCAGACATCTGCCTCCCA 2014-08-02 2014-08-02
snp_cf0052003988498 LJ7 G ATCAGTGTGTAGCTAGGTTCCAACTGGCAT TACGAGTGGGTATCAGACATCTGCCTCCCA 2014-07-19 2014-07-19
snp_cf0067003995741 TM8 G ATCAGTGTGTAGCTAGGTTCCAACTGGCAT TACGAGTGGGTATCAGACATCTGCCTCCCA 2014-07-19 2014-07-19
snp_cf0049004087239 LJ4 R ATCAGTGTGTAGCTAGGTTCCAACTGGCAT TACGAGTGGGTATCAGACATCTGCCTCCCA 2014-07-19 2014-07-19
snp_cf0012004044060 DQ4 R ATCAGTGTGTAGCTAGGTTCCAACTGGCAT TACGAGTGGGTATCAGACATCTGCCTCCCA 2014-07-19 2014-07-19
snp_cf0042004207540 KM7 R ATCAGTGTGTAGCTAGGTTCCAACTGGCAT TACGAGTGGGTATCAGACATCTGCCTCCCA 2014-07-19 2014-07-19
snp_cf0015004051992 DQ7 G ATCAGTGTGTAGCTAGGTTCCAACTGGCAT TACGAGTGGGTATCAGACATCTGCCTCCCA 2014-07-19 2014-07-19
snp_cf0071004150231 YJ2 R ATCAGTGTGTAGCTAGGTTCCAACTGGCAT TACGAGTGGGTATCAGACATCTGCCTCCCA 2014-07-19 2014-07-19
snp_cf0032003113853 GS8 G ATCAGTGTGTAGCTAGGTTCCAACTGGCAT TACGAGTGGGTATCAGACATCTGCCTCCCA 2014-07-19 2014-07-19
snp_cf0066004155332 TM7 G ATCAGTGTGTAGCTAGGTTCCAACTGGCAT TACGAGTGGGTATCAGACATCTGCCTCCCA 2014-07-19 2014-07-19
snp_cf0006004653537 CRW G ATCAGTGTGTAGCTAGGTTCCAACTGGCAT TACGAGTGGGTATCAGACATCTGCCTCCCA 2014-07-19 2014-07-19
snp_cf0022003592094 FAMICHN00002 G ATCAGTGTGTAGCTAGGTTCCAACTGGCAT TACGAGTGGGTATCAGACATCTGCCTCCCA 2014-07-19 2014-07-19
snp_cf0011004109040 DQ3 R ATCAGTGTGTAGCTAGGTTCCAACTGGCAT TACGAGTGGGTATCAGACATCTGCCTCCCA 2014-07-19 2014-07-19
snp_cf0034004678823 ISW G ATCAGTGTGTAGCTAGGTTCCAACTGGCAT TACGAGTGGGTATCAGACATCTGCCTCCCA 2014-07-19 2014-07-19
6.Fasta Information
GATATCCAAA GAACTTCTTC ATCAGTGTGT AGCTAGGTTC CAACTGGCAT
R
TACGAGTGGG TATCAGACAT CTGCCTCCCA TGCATGCACA CTTCTGAGAG