e.g. 1:1246..9423
SNP Detail For snp_cf0035003933626    [See in GBrowse]
1.General Information
SNP ID: snp_cf0035003933626
Organism: Canis familiaris
Individual: KM10
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: M
5'flank: GCCTTAAGAACGCAGCTAGTTGAGAGCTGG
3'flank: TTCCAGGCCTGCTTCCCTGTGAGAGCTGAG
3.Reference Map information
Chrom Position Reference KM10
Chr6 7469 C M
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0045003705048 LJ10 A GCCTTAAGAACGCAGCTAGTTGAGAGCTGG TTCCAGGCCTGCTTCCCTGTGAGAGCTGAG 2014-07-19 2014-07-19
snp_cf0032003113854 GS8 M GCCTTAAGAACGCAGCTAGTTGAGAGCTGG TTCCAGGCCTGCTTCCCTGTGAGAGCTGAG 2014-07-19 2014-07-19
snp_cf0024003182192 GS10 M GCCTTAAGAACGCAGCTAGTTGAGAGCTGG TTCCAGGCCTGCTTCCCTGTGAGAGCTGAG 2014-07-19 2014-07-19
6.Fasta Information
AATACTGCTG TCTTCTCTCT GCCTTAAGAA CGCAGCTAGT TGAGAGCTGG
M
TTCCAGGCCT GCTTCCCTGT GAGAGCTGAG TTCAGGGCAG AATCCTCCGC