e.g. 1:1246..9423
SNP Detail For snp_cf0035003933628    [See in GBrowse]
1.General Information
SNP ID: snp_cf0035003933628
Organism: Canis familiaris
Individual: KM10
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: S
5'flank: GCTGGTACCCTTCGCTTCTAAAACGCCTAG
3'flank: CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG
3.Reference Map information
Chrom Position Reference KM10
Chr6 8541 C S
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0053003966630 LJ8 G GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
snp_cf0040003514231 KM5 G GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
snp_cf0007003435851 Dingo G GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
snp_cf0063003978391 TM4 G GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
snp_cf0056005031892 LUPWRUS00001 G GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
snp_cf0050003770967 LJ5 G GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
snp_cf0065004038626 TM6 G GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
snp_cf0025003159435 GS1 G GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
snp_cf0047003950325 LJ2 G GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
snp_cf0019003148358 FAMBGSD00001 G GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
snp_cf0039003414069 KM4 S GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
snp_cf0016004058565 DQ8 G GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
snp_cf0062004065003 TM3 G GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
snp_cf0043003414754 KM8 G GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
snp_cf0044003571802 KM9 S GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
snp_cf0013003986887 DQ5 G GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
snp_cf0012004044061 DQ4 S GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
snp_cf0042004207541 KM7 S GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
snp_cf0071004150232 YJ2 G GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
snp_cf0014004015266 DQ6 G GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
snp_cf0077004127806 YJ8 G GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
snp_cf0022003592095 FAMICHN00002 G GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
snp_cf0066004155335 TM7 G GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
snp_cf0018003363661 FAMBBEM00001 G GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
snp_cf0048003863937 LJ3 G GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
snp_cf0055005003229 LUPWCHN00001 G GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
snp_cf0041004032390 KM6 S GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
snp_cf0009004049093 DQ1 G GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
snp_cf0017004107246 DQ9 G GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
snp_cf0027003153101 GS3 G GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
snp_cf0026003185963 GS2 S GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
snp_cf0036003237067 KM1 G GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
snp_cf0021003889741 FAMICHN00001 G GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
snp_cf0030003155644 GS6 S GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
snp_cf0037003373099 KM2 G GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
snp_cf0070004292775 YJ1 G GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
snp_cf0004003389321 Basenji G GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
snp_cf0020004016228 FAMBTIM00001 G GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
snp_cf0052003988500 LJ7 G GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
snp_cf0061004111689 TM2 G GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
snp_cf0049004087240 LJ4 S GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
snp_cf0051004050515 LJ6 G GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
snp_cf0029002989899 GS5 S GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
snp_cf0064004087418 TM5 G GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
snp_cf0058004995283 LUPWRUS00003 G GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
snp_cf0069004176015 YJ10 G GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
snp_cf0010004074970 DQ2 S GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
snp_cf0024003182194 GS10 S GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
snp_cf0038003274207 KM3 G GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
snp_cf0060003962512 TM1 G GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
snp_cf0031003200510 GS7 S GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
snp_cf0015004051993 DQ7 G GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
snp_cf0072004163250 YJ3 G GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
snp_cf0023003885111 FAMICHN00003 G GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
snp_cf0011004109041 DQ3 G GCTGGTACCCTTCGCTTCTAAAACGCCTAG CTCGCTGCTTGAAGGAAGTGTTGGGGGAGG 2014-07-19 2014-07-19
6.Fasta Information
TGTACCTCCA CATCCAGCCT GCTGGTACCC TTCGCTTCTA AAACGCCTAG
S
CTCGCTGCTT GAAGGAAGTG TTGGGGGAGG TAATTGGAAT CTCCCGGCAC