e.g. 1:1246..9423
SNP Detail For snp_cf0035003933632    [See in GBrowse]
1.General Information
SNP ID: snp_cf0035003933632
Organism: Canis familiaris
Individual: KM10
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: Y
5'flank: ATCCTGCCTGACTGTAGACGAAGCTGCTAA
3'flank: AACCTCATCTTAGTTGCTGAGAGAGGTTGT
3.Reference Map information
Chrom Position Reference KM10
Chr6 13440 C Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0040003514233 KM5 T ATCCTGCCTGACTGTAGACGAAGCTGCTAA AACCTCATCTTAGTTGCTGAGAGAGGTTGT 2014-07-19 2014-07-19
snp_cf0041004032392 KM6 Y ATCCTGCCTGACTGTAGACGAAGCTGCTAA AACCTCATCTTAGTTGCTGAGAGAGGTTGT 2014-07-19 2014-07-19
snp_cf0009004049095 DQ1 Y ATCCTGCCTGACTGTAGACGAAGCTGCTAA AACCTCATCTTAGTTGCTGAGAGAGGTTGT 2014-07-19 2014-07-19
snp_cf0053003966633 LJ8 Y ATCCTGCCTGACTGTAGACGAAGCTGCTAA AACCTCATCTTAGTTGCTGAGAGAGGTTGT 2014-07-19 2014-07-19
snp_cf0065004038629 TM6 Y ATCCTGCCTGACTGTAGACGAAGCTGCTAA AACCTCATCTTAGTTGCTGAGAGAGGTTGT 2014-07-19 2014-07-19
snp_cf0039003414072 KM4 Y ATCCTGCCTGACTGTAGACGAAGCTGCTAA AACCTCATCTTAGTTGCTGAGAGAGGTTGT 2014-07-19 2014-07-19
snp_cf0063003978395 TM4 Y ATCCTGCCTGACTGTAGACGAAGCTGCTAA AACCTCATCTTAGTTGCTGAGAGAGGTTGT 2014-07-19 2014-07-19
snp_cf0064004087421 TM5 Y ATCCTGCCTGACTGTAGACGAAGCTGCTAA AACCTCATCTTAGTTGCTGAGAGAGGTTGT 2014-07-19 2014-07-19
snp_cf0047003950328 LJ2 T ATCCTGCCTGACTGTAGACGAAGCTGCTAA AACCTCATCTTAGTTGCTGAGAGAGGTTGT 2014-07-19 2014-07-19
snp_cf0052003988505 LJ7 T ATCCTGCCTGACTGTAGACGAAGCTGCTAA AACCTCATCTTAGTTGCTGAGAGAGGTTGT 2014-07-19 2014-07-19
snp_cf0051004050516 LJ6 Y ATCCTGCCTGACTGTAGACGAAGCTGCTAA AACCTCATCTTAGTTGCTGAGAGAGGTTGT 2014-07-19 2014-07-19
snp_cf0061004111691 TM2 Y ATCCTGCCTGACTGTAGACGAAGCTGCTAA AACCTCATCTTAGTTGCTGAGAGAGGTTGT 2014-07-19 2014-07-19
snp_cf0043003414757 KM8 Y ATCCTGCCTGACTGTAGACGAAGCTGCTAA AACCTCATCTTAGTTGCTGAGAGAGGTTGT 2014-07-19 2014-07-19
snp_cf0007003435862 Dingo Y ATCCTGCCTGACTGTAGACGAAGCTGCTAA AACCTCATCTTAGTTGCTGAGAGAGGTTGT 2014-07-19 2014-07-19
snp_cf0017004107253 DQ9 Y ATCCTGCCTGACTGTAGACGAAGCTGCTAA AACCTCATCTTAGTTGCTGAGAGAGGTTGT 2014-07-19 2014-07-19
snp_cf0037003373100 KM2 Y ATCCTGCCTGACTGTAGACGAAGCTGCTAA AACCTCATCTTAGTTGCTGAGAGAGGTTGT 2014-07-19 2014-07-19
snp_cf0072004163253 YJ3 Y ATCCTGCCTGACTGTAGACGAAGCTGCTAA AACCTCATCTTAGTTGCTGAGAGAGGTTGT 2014-07-19 2014-07-19
snp_cf0071004150236 YJ2 Y ATCCTGCCTGACTGTAGACGAAGCTGCTAA AACCTCATCTTAGTTGCTGAGAGAGGTTGT 2014-07-19 2014-07-19
snp_cf0013003986890 DQ5 T ATCCTGCCTGACTGTAGACGAAGCTGCTAA AACCTCATCTTAGTTGCTGAGAGAGGTTGT 2014-07-19 2014-07-19
snp_cf0015004051995 DQ7 Y ATCCTGCCTGACTGTAGACGAAGCTGCTAA AACCTCATCTTAGTTGCTGAGAGAGGTTGT 2014-07-19 2014-07-19
snp_cf0042004207544 KM7 Y ATCCTGCCTGACTGTAGACGAAGCTGCTAA AACCTCATCTTAGTTGCTGAGAGAGGTTGT 2014-07-19 2014-07-19
snp_cf0036003237069 KM1 T ATCCTGCCTGACTGTAGACGAAGCTGCTAA AACCTCATCTTAGTTGCTGAGAGAGGTTGT 2014-07-19 2014-07-19
snp_cf0070004292780 YJ1 T ATCCTGCCTGACTGTAGACGAAGCTGCTAA AACCTCATCTTAGTTGCTGAGAGAGGTTGT 2014-07-19 2014-07-19
snp_cf0022003592096 FAMICHN00002 Y ATCCTGCCTGACTGTAGACGAAGCTGCTAA AACCTCATCTTAGTTGCTGAGAGAGGTTGT 2014-07-19 2014-07-19
snp_cf0010004074973 DQ2 Y ATCCTGCCTGACTGTAGACGAAGCTGCTAA AACCTCATCTTAGTTGCTGAGAGAGGTTGT 2014-07-19 2014-07-19
snp_cf0011004109043 DQ3 Y ATCCTGCCTGACTGTAGACGAAGCTGCTAA AACCTCATCTTAGTTGCTGAGAGAGGTTGT 2014-07-19 2014-07-19
snp_cf0018003363666 FAMBBEM00001 T ATCCTGCCTGACTGTAGACGAAGCTGCTAA AACCTCATCTTAGTTGCTGAGAGAGGTTGT 2014-07-19 2014-07-19
6.Fasta Information
TCGGGGGAGA ACCCTCCCAC ATCCTGCCTG ACTGTAGACG AAGCTGCTAA
Y
AACCTCATCT TAGTTGCTGA GAGAGGTTGT GAGAAAAGCA TGTGGAATAG