e.g. 1:1246..9423
SNP Detail For snp_cf0035000632986    [See in GBrowse]
1.General Information
SNP ID: snp_cf0035000632986
Organism: Canis familiaris
Individual: KM10
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: S
5'flank: TCACTGGCCCCGGCGCGGGTCACGTGGCCG
3'flank: CCCCGCCCCCGCCCCCGCCCCCGCCCCCCG
3.Reference Map information
Chrom Position Reference KM10
Chr13 41042 C S
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000000460 94 + C CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000000736 94 CCC => GCC,CCC ENSCAFP00000000679 32 P => A,P
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0023000620952 FAMICHN00003 G TCACTGGCCCCGGCGCGGGTCACGTGGCCG CCCCGCCCCCGCCCCCGCCCCCGCCCCCCG 2014-07-19 2014-07-19
snp_cf0004000554102 Basenji G TCACTGGCCCCGGCGCGGGTCACGTGGCCG CCCCGCCCCCGCCCCCGCCCCCGCCCCCCG 2014-07-19 2014-07-19
snp_cf0060000674557 TM1 G TCACTGGCCCCGGCGCGGGTCACGTGGCCG CCCCGCCCCCGCCCCCGCCCCCGCCCCCCG 2014-07-19 2014-07-19
snp_cf0014000647306 DQ6 G TCACTGGCCCCGGCGCGGGTCACGTGGCCG CCCCGCCCCCGCCCCCGCCCCCGCCCCCCG 2014-07-19 2014-07-19
snp_cf0037000531048 KM2 G TCACTGGCCCCGGCGCGGGTCACGTGGCCG CCCCGCCCCCGCCCCCGCCCCCGCCCCCCG 2014-07-19 2014-07-19
snp_cf0061000675099 TM2 G TCACTGGCCCCGGCGCGGGTCACGTGGCCG CCCCGCCCCCGCCCCCGCCCCCGCCCCCCG 2014-07-19 2014-07-19
snp_cf0062000664011 TM3 G TCACTGGCCCCGGCGCGGGTCACGTGGCCG CCCCGCCCCCGCCCCCGCCCCCGCCCCCCG 2014-07-19 2014-07-19
snp_cf0076000680053 YJ7 G TCACTGGCCCCGGCGCGGGTCACGTGGCCG CCCCGCCCCCGCCCCCGCCCCCGCCCCCCG 2014-07-19 2014-07-19
snp_cf0077000675668 YJ8 S TCACTGGCCCCGGCGCGGGTCACGTGGCCG CCCCGCCCCCGCCCCCGCCCCCGCCCCCCG 2014-07-19 2014-07-19
snp_cf0013000632733 DQ5 G TCACTGGCCCCGGCGCGGGTCACGTGGCCG CCCCGCCCCCGCCCCCGCCCCCGCCCCCCG 2014-07-19 2014-07-19
snp_cf0015000664497 DQ7 G TCACTGGCCCCGGCGCGGGTCACGTGGCCG CCCCGCCCCCGCCCCCGCCCCCGCCCCCCG 2014-07-19 2014-07-19
snp_cf0052000641928 LJ7 G TCACTGGCCCCGGCGCGGGTCACGTGGCCG CCCCGCCCCCGCCCCCGCCCCCGCCCCCCG 2014-07-19 2014-07-19
snp_cf0016000662205 DQ8 G TCACTGGCCCCGGCGCGGGTCACGTGGCCG CCCCGCCCCCGCCCCCGCCCCCGCCCCCCG 2014-07-19 2014-07-19
snp_cf0066000676665 TM7 G TCACTGGCCCCGGCGCGGGTCACGTGGCCG CCCCGCCCCCGCCCCCGCCCCCGCCCCCCG 2014-07-19 2014-07-19
snp_cf0049000663510 LJ4 G TCACTGGCCCCGGCGCGGGTCACGTGGCCG CCCCGCCCCCGCCCCCGCCCCCGCCCCCCG 2014-07-19 2014-07-19
snp_cf0059000671806 TM10 G TCACTGGCCCCGGCGCGGGTCACGTGGCCG CCCCGCCCCCGCCCCCGCCCCCGCCCCCCG 2014-07-19 2014-07-19
6.Fasta Information
CGCTGGAACC CGCGGTGACA TCACTGGCCC CGGCGCGGGT CACGTGGCCG
S
CCCCGCCCCC GCCCCCGCCC CCGCCCCCCG TCCCGCTCCC GCTCCTCCTC