e.g. 1:1246..9423
SNP Detail For snp_cf0036000000003    [See in GBrowse]
1.General Information
SNP ID: snp_cf0036000000003
Organism: Canis familiaris
Individual: KM1
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: S
5'flank: ACTGAGCCTGAACTCACGTGTATCTGAGTT
3'flank: AATACAGCGTTTTCCAACGGCCTTCTTCAA
3.Reference Map information
Chrom Position Reference KM1
Chr1 29763 G S
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0038000000003 KM3 S ACTGAGCCTGAACTCACGTGTATCTGAGTT AATACAGCGTTTTCCAACGGCCTTCTTCAA 2014-07-19 2014-07-19
snp_cf0037000000002 KM2 S ACTGAGCCTGAACTCACGTGTATCTGAGTT AATACAGCGTTTTCCAACGGCCTTCTTCAA 2014-07-19 2014-07-19
snp_cf0048000000003 LJ3 S ACTGAGCCTGAACTCACGTGTATCTGAGTT AATACAGCGTTTTCCAACGGCCTTCTTCAA 2014-07-19 2014-07-19
snp_cf0075000000007 YJ6 S ACTGAGCCTGAACTCACGTGTATCTGAGTT AATACAGCGTTTTCCAACGGCCTTCTTCAA 2014-07-19 2014-07-19
6.Fasta Information
TGGCAATAGC ATGTATAACC ACTGAGCCTG AACTCACGTG TATCTGAGTT
S
AATACAGCGT TTTCCAACGG CCTTCTTCAA TCAGAGTGTA GCTAGGTTCC