e.g. 1:1246..9423
SNP Detail For snp_cf0036000635314    [See in GBrowse]
1.General Information
SNP ID: snp_cf0036000635314
Organism: Canis familiaris
Individual: KM1
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: Y
5'flank: AGTGTGGTCTCTGCAGACATGATGCCATCT
3'flank: TGAAGTTGCAGTGGAAGGTCCCATTATCAA
3.Reference Map information
Chrom Position Reference KM1
Chr14 473162 T Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000024874 2862 - T CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000001758 386 AAA => AGA ENSCAFP00000001618 129 K => R
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0064000809284 TM5 Y AGTGTGGTCTCTGCAGACATGATGCCATCT TGAAGTTGCAGTGGAAGGTCCCATTATCAA 2014-07-19 2014-07-19
snp_cf0076000821256 YJ7 Y AGTGTGGTCTCTGCAGACATGATGCCATCT TGAAGTTGCAGTGGAAGGTCCCATTATCAA 2014-07-19 2014-07-19
snp_cf0070000841481 YJ1 Y AGTGTGGTCTCTGCAGACATGATGCCATCT TGAAGTTGCAGTGGAAGGTCCCATTATCAA 2014-07-19 2014-07-19
snp_cf0021000761655 FAMICHN00001 Y AGTGTGGTCTCTGCAGACATGATGCCATCT TGAAGTTGCAGTGGAAGGTCCCATTATCAA 2014-07-19 2014-07-19
snp_cf0042000804994 KM7 Y AGTGTGGTCTCTGCAGACATGATGCCATCT TGAAGTTGCAGTGGAAGGTCCCATTATCAA 2014-07-19 2014-07-19
snp_cf0053000777363 LJ8 Y AGTGTGGTCTCTGCAGACATGATGCCATCT TGAAGTTGCAGTGGAAGGTCCCATTATCAA 2014-07-19 2014-07-19
snp_cf0051000800620 LJ6 Y AGTGTGGTCTCTGCAGACATGATGCCATCT TGAAGTTGCAGTGGAAGGTCCCATTATCAA 2014-07-19 2014-07-19
snp_cf0054000721086 LJ9 Y AGTGTGGTCTCTGCAGACATGATGCCATCT TGAAGTTGCAGTGGAAGGTCCCATTATCAA 2014-07-19 2014-07-19
snp_cf0023000755073 FAMICHN00003 Y AGTGTGGTCTCTGCAGACATGATGCCATCT TGAAGTTGCAGTGGAAGGTCCCATTATCAA 2014-07-19 2014-07-19
snp_cf0045000710173 LJ10 Y AGTGTGGTCTCTGCAGACATGATGCCATCT TGAAGTTGCAGTGGAAGGTCCCATTATCAA 2014-07-19 2014-07-19
snp_cf0052000777050 LJ7 C AGTGTGGTCTCTGCAGACATGATGCCATCT TGAAGTTGCAGTGGAAGGTCCCATTATCAA 2014-07-19 2014-07-19
snp_cf0041000777879 KM6 Y AGTGTGGTCTCTGCAGACATGATGCCATCT TGAAGTTGCAGTGGAAGGTCCCATTATCAA 2014-07-19 2014-07-19
snp_cf0047000767493 LJ2 Y AGTGTGGTCTCTGCAGACATGATGCCATCT TGAAGTTGCAGTGGAAGGTCCCATTATCAA 2014-07-19 2014-07-19
snp_cf0049000805908 LJ4 Y AGTGTGGTCTCTGCAGACATGATGCCATCT TGAAGTTGCAGTGGAAGGTCCCATTATCAA 2014-07-19 2014-07-19
snp_cf0007000673233 Dingo Y AGTGTGGTCTCTGCAGACATGATGCCATCT TGAAGTTGCAGTGGAAGGTCCCATTATCAA 2014-07-19 2014-07-19
snp_cf0008000785637 DQ10 Y AGTGTGGTCTCTGCAGACATGATGCCATCT TGAAGTTGCAGTGGAAGGTCCCATTATCAA 2014-07-19 2014-07-19
snp_cf0017000815200 DQ9 Y AGTGTGGTCTCTGCAGACATGATGCCATCT TGAAGTTGCAGTGGAAGGTCCCATTATCAA 2014-07-19 2014-07-19
snp_cf0039000620281 KM4 Y AGTGTGGTCTCTGCAGACATGATGCCATCT TGAAGTTGCAGTGGAAGGTCCCATTATCAA 2014-07-19 2014-07-19
snp_cf0073000814018 YJ4 Y AGTGTGGTCTCTGCAGACATGATGCCATCT TGAAGTTGCAGTGGAAGGTCCCATTATCAA 2014-07-19 2014-07-19
snp_cf0044000712895 KM9 Y AGTGTGGTCTCTGCAGACATGATGCCATCT TGAAGTTGCAGTGGAAGGTCCCATTATCAA 2014-07-19 2014-07-19
snp_cf0075000825625 YJ6 Y AGTGTGGTCTCTGCAGACATGATGCCATCT TGAAGTTGCAGTGGAAGGTCCCATTATCAA 2014-07-19 2014-07-19
6.Fasta Information
CACCTGCCAC CCTCAGCCAC AGTGTGGTCT CTGCAGACAT GATGCCATCT
Y
TGAAGTTGCA GTGGAAGGTC CCATTATCAA GAGCAGTGAC ATTGTGAATC