e.g. 1:1246..9423
SNP Detail For snp_cf0036000635524    [See in GBrowse]
1.General Information
SNP ID: snp_cf0036000635524
Organism: Canis familiaris
Individual: KM1
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: S
5'flank: GTGTGCCCAGGGCACCTGGCCAGGGCCACC
3'flank: GGCCTCCGGGAGCGTGGCCAACTCCTCCCC
3.Reference Map information
Chrom Position Reference KM1
Chr14 669043 C S
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000001161 110343 - C CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000050108 21910 GGG => CGG ENSCAFP00000035951 7304 G => R
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0068000770453 TM9 S GTGTGCCCAGGGCACCTGGCCAGGGCCACC GGCCTCCGGGAGCGTGGCCAACTCCTCCCC 2014-07-19 2014-07-19
snp_cf0019000621026 FAMBGSD00001 S GTGTGCCCAGGGCACCTGGCCAGGGCCACC GGCCTCCGGGAGCGTGGCCAACTCCTCCCC 2014-07-19 2014-07-19
snp_cf0025000604127 GS1 S GTGTGCCCAGGGCACCTGGCCAGGGCCACC GGCCTCCGGGAGCGTGGCCAACTCCTCCCC 2014-07-19 2014-07-19
snp_cf0020000792673 FAMBTIM00001 S GTGTGCCCAGGGCACCTGGCCAGGGCCACC GGCCTCCGGGAGCGTGGCCAACTCCTCCCC 2014-07-19 2014-07-19
snp_cf0040000705967 KM5 S GTGTGCCCAGGGCACCTGGCCAGGGCCACC GGCCTCCGGGAGCGTGGCCAACTCCTCCCC 2014-07-19 2014-07-19
snp_cf0014000788710 DQ6 S GTGTGCCCAGGGCACCTGGCCAGGGCCACC GGCCTCCGGGAGCGTGGCCAACTCCTCCCC 2014-07-19 2014-07-19
snp_cf0029000562849 GS5 S GTGTGCCCAGGGCACCTGGCCAGGGCCACC GGCCTCCGGGAGCGTGGCCAACTCCTCCCC 2014-07-19 2014-07-19
snp_cf0053000777575 LJ8 S GTGTGCCCAGGGCACCTGGCCAGGGCCACC GGCCTCCGGGAGCGTGGCCAACTCCTCCCC 2014-07-19 2014-07-19
snp_cf0071000817761 YJ2 S GTGTGCCCAGGGCACCTGGCCAGGGCCACC GGCCTCCGGGAGCGTGGCCAACTCCTCCCC 2014-07-19 2014-07-19
snp_cf0042000805229 KM7 S GTGTGCCCAGGGCACCTGGCCAGGGCCACC GGCCTCCGGGAGCGTGGCCAACTCCTCCCC 2014-07-19 2014-07-19
snp_cf0038000633401 KM3 G GTGTGCCCAGGGCACCTGGCCAGGGCCACC GGCCTCCGGGAGCGTGGCCAACTCCTCCCC 2014-07-19 2014-07-19
snp_cf0027000621297 GS3 S GTGTGCCCAGGGCACCTGGCCAGGGCCACC GGCCTCCGGGAGCGTGGCCAACTCCTCCCC 2014-07-19 2014-07-19
snp_cf0033000619320 GS9 S GTGTGCCCAGGGCACCTGGCCAGGGCCACC GGCCTCCGGGAGCGTGGCCAACTCCTCCCC 2014-07-19 2014-07-19
snp_cf0059000811920 TM10 S GTGTGCCCAGGGCACCTGGCCAGGGCCACC GGCCTCCGGGAGCGTGGCCAACTCCTCCCC 2014-07-19 2014-07-19
snp_cf0077000818226 YJ8 S GTGTGCCCAGGGCACCTGGCCAGGGCCACC GGCCTCCGGGAGCGTGGCCAACTCCTCCCC 2014-07-19 2014-07-19
snp_cf0041000778114 KM6 S GTGTGCCCAGGGCACCTGGCCAGGGCCACC GGCCTCCGGGAGCGTGGCCAACTCCTCCCC 2014-07-19 2014-07-19
snp_cf0039000620496 KM4 S GTGTGCCCAGGGCACCTGGCCAGGGCCACC GGCCTCCGGGAGCGTGGCCAACTCCTCCCC 2014-07-19 2014-07-19
snp_cf0002000524249 CID1 G GTGTGCCCAGGGCACCTGGCCAGGGCCACC GGCCTCCGGGAGCGTGGCCAACTCCTCCCC 2014-08-02 2014-08-02
snp_cf0016000795938 DQ8 S GTGTGCCCAGGGCACCTGGCCAGGGCCACC GGCCTCCGGGAGCGTGGCCAACTCCTCCCC 2014-07-19 2014-07-19
6.Fasta Information
AGTGATGTGC AAGCTGGCTG GTGTGCCCAG GGCACCTGGC CAGGGCCACC
S
GGCCTCCGGG AGCGTGGCCA ACTCCTCCCC GGCCTCAGAC TCAGGGGAGG