e.g. 1:1246..9423
SNP Detail For snp_cf0036000635560    [See in GBrowse]
1.General Information
SNP ID: snp_cf0036000635560
Organism: Canis familiaris
Individual: KM1
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: T
5'flank: GCTCACCTTTGACCATGACAGAAGCCATGG
3'flank: TTTCTGACCACCGGCCACGCAGACGTACTC
3.Reference Map information
Chrom Position Reference KM1
Chr14 713914 G T
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000001161 65472 - G CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000001792 10717 CCC => ACC ENSCAFP00000001649 3573 P => T
- ENSCAFT00000050108 12397 CCC => ACC ENSCAFP00000035951 4133 P => T
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0076000821500 YJ7 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0067000778357 TM8 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0075000825896 YJ6 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0072000824162 YJ3 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0025000604168 GS1 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0056001015638 LUPWRUS00001 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0010000800581 DQ2 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0049000806110 LJ4 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0054000721291 LJ9 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0069000824242 YJ10 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0030000644121 GS6 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0019000621067 FAMBGSD00001 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0004000659687 Basenji T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0077000818274 YJ8 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0063000791150 TM4 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0017000815457 DQ9 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0008000785901 DQ10 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0014000788733 DQ6 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0044000713063 KM9 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0073000814249 YJ4 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0012000803444 DQ4 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0047000767685 LJ2 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0062000804431 TM3 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0023000755326 FAMICHN00003 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0051000800867 LJ6 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0068000770459 TM9 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0021000761867 FAMICHN00001 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0071000817788 YJ2 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0059000811926 TM10 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0038000633408 KM3 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0031000640093 GS7 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0058001005006 LUPWRUS00003 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0053000777585 LJ8 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0070000841707 YJ1 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0041000778158 KM6 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0033000619367 GS9 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0043000656701 KM8 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0016000795948 DQ8 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0006000920320 CRW T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0026000611212 GS2 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0055001004273 LUPWCHN00001 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0042000805275 KM7 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0040000706015 KM5 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0024000649966 GS10 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0034000944657 ISW K GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0020000792708 FAMBTIM00001 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0037000660372 KM2 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0028000594144 GS4 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0011000807338 DQ3 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0048000760704 LJ3 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0029000562886 GS5 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0074000811883 YJ5 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0061000811950 TM2 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0022000711514 FAMICHN00002 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0066000815441 TM7 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0007000673436 Dingo T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0064000809517 TM5 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0046000733339 LJ1 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0057000983577 LUPWRUS00002 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0032000614450 GS8 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0005000991563 CHW T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0052000777316 LJ7 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0065000780452 TM6 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0027000621346 GS3 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0018000669869 FAMBBEM00001 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0060000804550 TM1 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0015000803111 DQ7 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0009000802748 DQ1 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0013000773658 DQ5 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0035000778139 KM10 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0078000816133 YJ9 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
snp_cf0039000620532 KM4 T GCTCACCTTTGACCATGACAGAAGCCATGG TTTCTGACCACCGGCCACGCAGACGTACTC 2014-07-19 2014-07-19
6.Fasta Information
GAAAGTGTGT GGCAGCGAGG GCTCACCTTT GACCATGACA GAAGCCATGG
T
TTTCTGACCA CCGGCCACGC AGACGTACTC GCCAGTGTCT TTGGGCTCTA