e.g. 1:1246..9423
SNP Detail For snp_cf0037001444961    [See in GBrowse]
1.General Information
SNP ID: snp_cf0037001444961
Organism: Canis familiaris
Individual: KM2
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: C
5'flank: CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA
3'flank: GACAGCCATGTCCCAGAACATGTTTGGACC
3.Reference Map information
Chrom Position Reference KM2
Chr20 33597 T C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000030878 7923 - T CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000045665 223 ATC => GTC ENSCAFP00000039078 75 I => V
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0011001733282 DQ3 C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0069001765759 YJ10 C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0060001678429 TM1 C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0048001618368 LJ3 C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0020001694904 FAMBTIM00001 C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0067001677825 TM8 C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0033001343423 GS9 Y CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0002001125183 CID1 C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-08-02 2014-08-02
snp_cf0023001602692 FAMICHN00003 C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0056002161350 LUPWRUS00001 C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0016001711046 DQ8 C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0062001712606 TM3 C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0070001805985 YJ1 C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0043001436347 KM8 C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0061001733018 TM2 C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0034002012405 ISW C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0040001516424 KM5 Y CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0029001230385 GS5 Y CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0041001725184 KM6 Y CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0005002029618 CHW C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0076001760863 YJ7 C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0044001508210 KM9 C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0010001684987 DQ2 C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0012001693107 DQ4 C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0059001700579 TM10 C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0004001434476 Basenji C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0015001706226 DQ7 C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0077001733795 YJ8 C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0036001341278 KM1 C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0013001628687 DQ5 C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0055002134646 LUPWCHN00001 C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0046001581150 LJ1 C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0054001525434 LJ9 C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0035001656998 KM10 C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0057002052056 LUPWRUS00002 C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0049001721934 LJ4 C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0078001745848 YJ9 C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0058002139473 LUPWRUS00003 C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0051001698935 LJ6 C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0072001754084 YJ3 C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0052001666837 LJ7 Y CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0063001682308 TM4 C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0007001469623 Dingo C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0053001658347 LJ8 C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0075001747549 YJ6 C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0064001718203 TM5 C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0006001975451 CRW C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0039001410964 KM4 Y CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0008001705877 DQ10 C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0019001305516 FAMBGSD00001 Y CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0014001678314 DQ6 C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0074001725035 YJ5 C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0045001537225 LJ10 C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0009001709282 DQ1 C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0047001654314 LJ2 C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0021001625771 FAMICHN00001 C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0042001786592 KM7 Y CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0066001742963 TM7 C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0022001528674 FAMICHN00002 C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0065001689480 TM6 C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0017001726685 DQ9 C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0071001742518 YJ2 Y CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0068001665352 TM9 C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0050001583582 LJ5 C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0026001313229 GS2 Y CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
snp_cf0073001702111 YJ4 C CAGTAGGTGCCTCCTGTGTTGCTTTCAGGA GACAGCCATGTCCCAGAACATGTTTGGACC 2014-07-19 2014-07-19
6.Fasta Information
GTAGCTGCCA ATGGTTGAGC CAGTAGGTGC CTCCTGTGTT GCTTTCAGGA
C
GACAGCCATG TCCCAGAACA TGTTTGGACC CTAGAGACAA CAAAGCCCAG