e.g. 1:1246..9423
SNP Detail For snp_cf0037001444963    [See in GBrowse]
1.General Information
SNP ID: snp_cf0037001444963
Organism: Canis familiaris
Individual: KM2
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: C
5'flank: GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT
3'flank: TGCACAGAGGGGACTGCACGACCCCAGGAG
3.Reference Map information
Chrom Position Reference KM2
Chr20 34295 T C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000030878 7225 - T intron
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0020001694906 FAMBTIM00001 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0011001733284 DQ3 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0024001360248 GS10 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0056002161353 LUPWRUS00001 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0067001677827 TM8 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0033001343425 GS9 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0038001351957 KM3 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0028001275192 GS4 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0035001657000 KM10 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0023001602694 FAMICHN00003 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0002001125185 CID1 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-08-02 2014-08-02
snp_cf0070001805987 YJ1 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0062001712608 TM3 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0016001711048 DQ8 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0034002012407 ISW C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0043001436349 KM8 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0069001765761 YJ10 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0032001311251 GS8 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0040001516426 KM5 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0041001725186 KM6 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0074001725038 YJ5 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0076001760865 YJ7 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0044001508212 KM9 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0010001684989 DQ2 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0012001693109 DQ4 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0015001706228 DQ7 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0077001733797 YJ8 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0031001336099 GS7 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0036001341280 KM1 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0027001339384 GS3 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0030001325404 GS6 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0055002134649 LUPWCHN00001 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0013001628689 DQ5 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0072001754086 YJ3 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0059001700581 TM10 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0001000761813 solidGW1 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-08-01 2014-08-01
snp_cf0057002052058 LUPWRUS00002 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0005002029620 CHW C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0052001666839 LJ7 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0058002139475 LUPWRUS00003 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0049001721936 LJ4 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0071001742520 YJ2 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0053001658349 LJ8 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0064001718205 TM5 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0009001709284 DQ1 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0004001434478 Basenji C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0039001410966 KM4 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0008001705879 DQ10 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0075001747551 YJ6 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0014001678316 DQ6 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0042001786594 KM7 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0078001745851 YJ9 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0006001975454 CRW C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0029001230387 GS5 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0021001625773 FAMICHN00001 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0026001313231 GS2 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0025001331547 GS1 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0019001305518 FAMBGSD00001 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0060001678431 TM1 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0066001742965 TM7 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0061001733020 TM2 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0065001689482 TM6 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0068001665354 TM9 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0007001469626 Dingo C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0017001726687 DQ9 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0063001682310 TM4 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0073001702113 YJ4 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
snp_cf0018001438706 FAMBBEM00001 C GAGCAGCTCAGAGGCGCTCCAGCAGAGGCT TGCACAGAGGGGACTGCACGACCCCAGGAG 2014-07-19 2014-07-19
6.Fasta Information
GCACACCTGG CTGGACCCAG GAGCAGCTCA GAGGCGCTCC AGCAGAGGCT
C
TGCACAGAGG GGACTGCACG ACCCCAGGAG CAGCTTGGGA GTGGCTCAGA