e.g. 1:1246..9423
SNP Detail For snp_cf0037001444964    [See in GBrowse]
1.General Information
SNP ID: snp_cf0037001444964
Organism: Canis familiaris
Individual: KM2
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: GGACTAAACAATCCTCAATATATATGCTCC
3'flank: AATGTGGGAGCTGCCAAATATATCAATCAA
3.Reference Map information
Chrom Position Reference KM2
Chr20 36336 A G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000030878 5184 - A intron
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0043001436350 KM8 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0038001351958 KM3 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0020001694907 FAMBTIM00001 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0012001693110 DQ4 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0024001360249 GS10 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0011001733285 DQ3 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0033001343426 GS9 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0067001677828 TM8 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0056002161354 LUPWRUS00001 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0028001275193 GS4 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0035001657001 KM10 R GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0023001602695 FAMICHN00003 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0070001805988 YJ1 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0031001336100 GS7 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0062001712609 TM3 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0016001711049 DQ8 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0034002012408 ISW G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0069001765762 YJ10 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0032001311252 GS8 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0021001625774 FAMICHN00001 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0040001516427 KM5 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0076001760866 YJ7 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0041001725187 KM6 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0045001537227 LJ10 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0078001745852 YJ9 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0015001706229 DQ7 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0044001508213 KM9 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0077001733798 YJ8 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0030001325405 GS6 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0064001718206 TM5 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0046001581152 LJ1 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0027001339385 GS3 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0059001700582 TM10 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0054001525436 LJ9 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0048001618370 LJ3 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0036001341281 KM1 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0072001754087 YJ3 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0005002029621 CHW G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0008001705880 DQ10 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0074001725040 YJ5 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0057002052059 LUPWRUS00002 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0010001684990 DQ2 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0049001721937 LJ4 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0058002139476 LUPWRUS00003 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0068001665355 TM9 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0071001742521 YJ2 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0009001709285 DQ1 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0053001658350 LJ8 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0004001434479 Basenji G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0075001747552 YJ6 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0039001410967 KM4 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0013001628690 DQ5 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0014001678317 DQ6 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0042001786595 KM7 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0006001975457 CRW G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0051001698937 LJ6 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0029001230388 GS5 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0055002134650 LUPWCHN00001 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0026001313232 GS2 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0047001654316 LJ2 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0066001742966 TM7 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0025001331548 GS1 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0019001305519 FAMBGSD00001 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0060001678432 TM1 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0052001666840 LJ7 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0022001528676 FAMICHN00002 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0061001733021 TM2 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0050001583584 LJ5 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0065001689483 TM6 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0007001469628 Dingo G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0018001438707 FAMBBEM00001 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0017001726688 DQ9 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0063001682311 TM4 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
snp_cf0073001702114 YJ4 G GGACTAAACAATCCTCAATATATATGCTCC AATGTGGGAGCTGCCAAATATATCAATCAA 2014-07-19 2014-07-19
6.Fasta Information
AAAGGATCTA TCCAAGAAGA GGACTAAACA ATCCTCAATA TATATGCTCC
G
AATGTGGGAG CTGCCAAATA TATCAATCAA CTAATAACCA AAGTTAAGAC