e.g. 1:1246..9423
SNP Detail For snp_cf0037001444973    [See in GBrowse]
1.General Information
SNP ID: snp_cf0037001444973
Organism: Canis familiaris
Individual: KM2
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: K
5'flank: CCTTGAGACATAGCCTCTTTCTCAGCAGTC
3'flank: GGATAGCCTTCAGTTTAGCACAGCTCCCGG
3.Reference Map information
Chrom Position Reference KM2
Chr20 122491 G K
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000003765 7934 + G intron
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0039001411030 KM4 K CCTTGAGACATAGCCTCTTTCTCAGCAGTC GGATAGCCTTCAGTTTAGCACAGCTCCCGG 2014-07-19 2014-07-19
snp_cf0026001313296 GS2 K CCTTGAGACATAGCCTCTTTCTCAGCAGTC GGATAGCCTTCAGTTTAGCACAGCTCCCGG 2014-07-19 2014-07-19
snp_cf0019001305578 FAMBGSD00001 K CCTTGAGACATAGCCTCTTTCTCAGCAGTC GGATAGCCTTCAGTTTAGCACAGCTCCCGG 2014-07-19 2014-07-19
6.Fasta Information
CCGCGTAGCT CTGCCTCGCG CCTTGAGACA TAGCCTCTTT CTCAGCAGTC
K
GGATAGCCTT CAGTTTAGCA CAGCTCCCGG CAGTGCCTCC TGTGCCAGCC