e.g. 1:1246..9423
SNP Detail For snp_cf0038003531373    [See in GBrowse]
1.General Information
SNP ID: snp_cf0038003531373
Organism: Canis familiaris
Individual: KM3
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs24509055  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: T
5'flank: GGTGCGAGCGATGTTGGTGATGGGGCTGCA
3'flank: ACCTGCTGCCGGGTGTGGATAACATTGACC
3.Reference Map information
Chrom Position Reference KM3
Chr8 46157 C T
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000010650 128 - C NON_CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0036003477193 KM1 Y GGTGCGAGCGATGTTGGTGATGGGGCTGCA ACCTGCTGCCGGGTGTGGATAACATTGACC 2014-07-19 2014-07-19
snp_cf0042004517162 KM7 Y GGTGCGAGCGATGTTGGTGATGGGGCTGCA ACCTGCTGCCGGGTGTGGATAACATTGACC 2014-07-19 2014-07-19
snp_cf0025003402344 GS1 T GGTGCGAGCGATGTTGGTGATGGGGCTGCA ACCTGCTGCCGGGTGTGGATAACATTGACC 2014-07-19 2014-07-19
snp_cf0043003676626 KM8 Y GGTGCGAGCGATGTTGGTGATGGGGCTGCA ACCTGCTGCCGGGTGTGGATAACATTGACC 2014-07-19 2014-07-19
snp_cf0003002494226 dbSNP139 T GGTGCGAGCGATGTTGGTGATGGGGCTGCA ACCTGCTGCCGGGTGTGGATAACATTGACC 2014-07-19 2014-07-19
snp_cf0044003845293 KM9 Y GGTGCGAGCGATGTTGGTGATGGGGCTGCA ACCTGCTGCCGGGTGTGGATAACATTGACC 2014-07-19 2014-07-19
snp_cf0027003400947 GS3 T GGTGCGAGCGATGTTGGTGATGGGGCTGCA ACCTGCTGCCGGGTGTGGATAACATTGACC 2014-07-19 2014-07-19
snp_cf0005005242404 CHW Y GGTGCGAGCGATGTTGGTGATGGGGCTGCA ACCTGCTGCCGGGTGTGGATAACATTGACC 2014-07-19 2014-07-19
snp_cf0059004350531 TM10 Y GGTGCGAGCGATGTTGGTGATGGGGCTGCA ACCTGCTGCCGGGTGTGGATAACATTGACC 2014-07-19 2014-07-19
snp_cf0028003292701 GS4 T GGTGCGAGCGATGTTGGTGATGGGGCTGCA ACCTGCTGCCGGGTGTGGATAACATTGACC 2014-07-19 2014-07-19
snp_cf0051004356045 LJ6 Y GGTGCGAGCGATGTTGGTGATGGGGCTGCA ACCTGCTGCCGGGTGTGGATAACATTGACC 2014-07-19 2014-07-19
snp_cf0019003389815 FAMBGSD00001 T GGTGCGAGCGATGTTGGTGATGGGGCTGCA ACCTGCTGCCGGGTGTGGATAACATTGACC 2014-07-19 2014-07-19
snp_cf0006005007874 CRW Y GGTGCGAGCGATGTTGGTGATGGGGCTGCA ACCTGCTGCCGGGTGTGGATAACATTGACC 2014-07-19 2014-07-19
snp_cf0057005164442 LUPWRUS00002 Y GGTGCGAGCGATGTTGGTGATGGGGCTGCA ACCTGCTGCCGGGTGTGGATAACATTGACC 2014-07-19 2014-07-19
snp_cf0068004306708 TM9 Y GGTGCGAGCGATGTTGGTGATGGGGCTGCA ACCTGCTGCCGGGTGTGGATAACATTGACC 2014-07-19 2014-07-19
snp_cf0032003357478 GS8 T GGTGCGAGCGATGTTGGTGATGGGGCTGCA ACCTGCTGCCGGGTGTGGATAACATTGACC 2014-07-19 2014-07-19
snp_cf0026003423822 GS2 T GGTGCGAGCGATGTTGGTGATGGGGCTGCA ACCTGCTGCCGGGTGTGGATAACATTGACC 2014-07-19 2014-07-19
snp_cf0039003686225 KM4 Y GGTGCGAGCGATGTTGGTGATGGGGCTGCA ACCTGCTGCCGGGTGTGGATAACATTGACC 2014-07-19 2014-07-19
snp_cf0033003419519 GS9 T GGTGCGAGCGATGTTGGTGATGGGGCTGCA ACCTGCTGCCGGGTGTGGATAACATTGACC 2014-07-19 2014-07-19
snp_cf0041004329868 KM6 Y GGTGCGAGCGATGTTGGTGATGGGGCTGCA ACCTGCTGCCGGGTGTGGATAACATTGACC 2014-07-19 2014-07-19
snp_cf0030003388724 GS6 T GGTGCGAGCGATGTTGGTGATGGGGCTGCA ACCTGCTGCCGGGTGTGGATAACATTGACC 2014-07-19 2014-07-19
snp_cf0035004236813 KM10 Y GGTGCGAGCGATGTTGGTGATGGGGCTGCA ACCTGCTGCCGGGTGTGGATAACATTGACC 2014-07-19 2014-07-19
snp_cf0040003764912 KM5 Y GGTGCGAGCGATGTTGGTGATGGGGCTGCA ACCTGCTGCCGGGTGTGGATAACATTGACC 2014-07-19 2014-07-19
snp_cf0024003428865 GS10 T GGTGCGAGCGATGTTGGTGATGGGGCTGCA ACCTGCTGCCGGGTGTGGATAACATTGACC 2014-07-19 2014-07-19
snp_cf0031003440280 GS7 Y GGTGCGAGCGATGTTGGTGATGGGGCTGCA ACCTGCTGCCGGGTGTGGATAACATTGACC 2014-07-19 2014-07-19
snp_cf0029003209678 GS5 T GGTGCGAGCGATGTTGGTGATGGGGCTGCA ACCTGCTGCCGGGTGTGGATAACATTGACC 2014-07-19 2014-07-19
snp_cf0037003627233 KM2 Y GGTGCGAGCGATGTTGGTGATGGGGCTGCA ACCTGCTGCCGGGTGTGGATAACATTGACC 2014-07-19 2014-07-19
6.Fasta Information
CGCTTAACAT GGAAGAAACT GGTGCGAGCG ATGTTGGTGA TGGGGCTGCA
T
ACCTGCTGCC GGGTGTGGAT AACATTGACC CGAAAGCATC CACTGCATTC