e.g. 1:1246..9423
SNP Detail For snp_cf0038003531448    [See in GBrowse]
1.General Information
SNP ID: snp_cf0038003531448
Organism: Canis familiaris
Individual: KM3
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs24480219  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: C
5'flank: GAGGGAACAGGACACAGGTCCTCCGTCCTG
3'flank: GACACTCGGATCTGGGGCTTTGCCTCCAAA
3.Reference Map information
Chrom Position Reference KM3
Chr8 170619 T C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000010670 26029 - T NON_CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0035004236909 KM10 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0013004292681 DQ5 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0024003428940 GS10 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0017004406635 DQ9 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0027003401022 GS3 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0001001924492 solidGW1 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-08-01 2014-08-01
snp_cf0051004356138 LJ6 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0023004181595 FAMICHN00003 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0075004459400 YJ6 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0039003686319 KM4 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0012004350917 DQ4 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0043003676720 KM8 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0062004366441 TM3 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0033003419594 GS9 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0049004397381 LJ4 Y GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0030003388799 GS6 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0042004517257 KM7 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0078004445038 YJ9 Y GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0066004466175 TM7 Y GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0009004356975 DQ1 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0020004310938 FAMBTIM00001 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0068004306804 TM9 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0059004350628 TM10 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0074004380316 YJ5 Y GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0077004439576 YJ8 Y GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0032003357553 GS8 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0037003627329 KM2 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0070004608119 YJ1 Y GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0008004426290 DQ10 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0025003402419 GS1 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0058005365855 LUPWRUS00003 Y GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0057005164528 LUPWRUS00002 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0061004420268 TM2 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0011004420364 DQ3 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0053004262262 LJ8 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0005005242495 CHW C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0040003765005 KM5 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0067004304982 TM8 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0028003292776 GS4 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0041004329964 KM6 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0065004328868 TM6 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0044003845390 KM9 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0046004075827 LJ1 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0003002494342 dbSNP139 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0072004479197 YJ3 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0064004395252 TM5 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0073004353533 YJ4 Y GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0026003423897 GS2 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0002002908772 CID1 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-08-02 2014-08-02
snp_cf0036003477287 KM1 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0031003440372 GS7 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0048004155362 LJ3 Y GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0018003626642 FAMBBEM00001 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0019003389891 FAMBGSD00001 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0010004377762 DQ2 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0034005042208 ISW C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0014004321552 DQ6 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0015004358870 DQ7 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0006005007953 CRW C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0052004293674 LJ7 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0021004181919 FAMICHN00001 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0047004240638 LJ2 Y GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0054004007656 LJ9 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0076004483434 YJ7 Y GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0056005411138 LUPWRUS00001 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0007003698609 Dingo C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0063004281809 TM4 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0004003644644 Basenji C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0060004269487 TM1 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0071004450215 YJ2 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0022003870342 FAMICHN00002 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0055005386691 LUPWCHN00001 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0016004360149 DQ8 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
snp_cf0029003209753 GS5 C GAGGGAACAGGACACAGGTCCTCCGTCCTG GACACTCGGATCTGGGGCTTTGCCTCCAAA 2014-07-19 2014-07-19
6.Fasta Information
ATGCCAGCGA GCACCAGCTG GAGGGAACAG GACACAGGTC CTCCGTCCTG
C
GACACTCGGA TCTGGGGCTT TGCCTCCAAA ACGGAGACCA TGCCTGTCCA