e.g. 1:1246..9423
SNP Detail For snp_cf0038003531451    [See in GBrowse]
1.General Information
SNP ID: snp_cf0038003531451
Organism: Canis familiaris
Individual: KM3
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs24481131  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: TCTAGGGGAAGAACAGAGACGCCAGAGCGC
3'flank: TGTGTGTGGGAACGAATCTCCGCGAGGGCA
3.Reference Map information
Chrom Position Reference KM3
Chr8 174400 T G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000010670 22248 - T intron
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0070004608122 YJ1 K TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0021004181923 FAMICHN00001 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0043003676724 KM8 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0013004292686 DQ5 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0078004445041 YJ9 K TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0012004350919 DQ4 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0042004517261 KM7 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0075004459403 YJ6 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0027003401025 GS3 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0009004356980 DQ1 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0001001924497 solidGW1 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-08-01 2014-08-01
snp_cf0062004366443 TM3 K TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0061004420270 TM2 K TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0033003419597 GS9 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0049004397383 LJ4 K TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0066004466178 TM7 K TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0023004181598 FAMICHN00003 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0015004358872 DQ7 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0056005411146 LUPWRUS00001 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0034005042212 ISW G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0047004240641 LJ2 K TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0072004479201 YJ3 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0068004306808 TM9 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0077004439578 YJ8 K TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0008004426294 DQ10 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0032003357556 GS8 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0026003423900 GS2 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0065004328872 TM6 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0074004380318 YJ5 K TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0051004356143 LJ6 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0041004329968 KM6 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0058005365859 LUPWRUS00003 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0011004420368 DQ3 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0040003765009 KM5 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0035004236913 KM10 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0028003292779 GS4 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0067004304984 TM8 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0053004262267 LJ8 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0037003627333 KM2 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0017004406637 DQ9 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0024003428943 GS10 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0036003477291 KM1 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0003002494345 dbSNP139 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0057005164533 LUPWRUS00002 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0025003402422 GS1 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0044003845394 KM9 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0064004395255 TM5 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0002002908773 CID1 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-08-02 2014-08-02
snp_cf0005005242500 CHW G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0073004353536 YJ4 K TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0016004360152 DQ8 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0031003440376 GS7 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0020004310941 FAMBTIM00001 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0007003698612 Dingo G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0019003389894 FAMBGSD00001 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0059004350632 TM10 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0060004269490 TM1 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0018003626644 FAMBBEM00001 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0052004293679 LJ7 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0010004377766 DQ2 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0063004281811 TM4 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0030003388802 GS6 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0054004007659 LJ9 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0039003686324 KM4 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0014004321556 DQ6 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0076004483437 YJ7 K TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0004003644646 Basenji G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0071004450217 YJ2 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0050004055074 LJ5 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0022003870345 FAMICHN00002 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0055005386695 LUPWCHN00001 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0029003209756 GS5 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0045003997411 LJ10 K TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
snp_cf0046004075830 LJ1 G TCTAGGGGAAGAACAGAGACGCCAGAGCGC TGTGTGTGGGAACGAATCTCCGCGAGGGCA 2014-07-19 2014-07-19
6.Fasta Information
GCCGTGACGC GGACGTGTGC TCTAGGGGAA GAACAGAGAC GCCAGAGCGC
G
TGTGTGTGGG AACGAATCTC CGCGAGGGCA GCAGAGGTGC ACAAGAGCCA