e.g. 1:1246..9423
SNP Detail For snp_cf0038003531455    [See in GBrowse]
1.General Information
SNP ID: snp_cf0038003531455
Organism: Canis familiaris
Individual: KM3
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs24523733  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: T
5'flank: TCTTTTCTCACACTTGGGAGTCATGGGCCA
3'flank: GGGAATGTGTTGAAGTTCATTTTAACTTGA
3.Reference Map information
Chrom Position Reference KM3
Chr8 177724 C T
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000010670 18924 - C intron
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0075004459408 YJ6 T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0006005007962 CRW Y TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0032003357560 GS8 T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0066004466180 TM7 Y TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0009004356984 DQ1 T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0021004181927 FAMICHN00001 T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0043003676728 KM8 T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0054004007663 LJ9 T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0070004608127 YJ1 Y TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0062004366447 TM3 Y TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0071004450221 YJ2 T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0068004306812 TM9 T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0010004377771 DQ2 T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0028003292783 GS4 T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0029003209760 GS5 T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0058005365864 LUPWRUS00003 Y TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0015004358876 DQ7 T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0053004262272 LJ8 T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0052004293683 LJ7 T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0061004420274 TM2 Y TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0047004240643 LJ2 Y TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0011004420371 DQ3 T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0041004329973 KM6 T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0013004292691 DQ5 T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0051004356148 LJ6 T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0008004426299 DQ10 T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0026003423904 GS2 T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0017004406641 DQ9 T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0073004353540 YJ4 Y TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0065004328877 TM6 T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0067004304988 TM8 T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0037003627337 KM2 T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0056005411152 LUPWRUS00001 T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0024003428947 GS10 T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0027003401029 GS3 T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0035004236917 KM10 T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0072004479208 YJ3 T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0042004517266 KM7 T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0077004439580 YJ8 Y TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0031003440380 GS7 T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0025003402426 GS1 T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0020004310945 FAMBTIM00001 T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0014004321560 DQ6 T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0036003477295 KM1 T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0074004380322 YJ5 Y TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0033003419601 GS9 T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0044003845398 KM9 T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0055005386700 LUPWCHN00001 T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0002002908775 CID1 T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-08-02 2014-08-02
snp_cf0040003765013 KM5 T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0005005242505 CHW T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0060004269495 TM1 T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0016004360157 DQ8 T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0007003698614 Dingo T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0048004155364 LJ3 Y TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0057005164537 LUPWRUS00002 Y TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0059004350636 TM10 T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0046004075834 LJ1 Y TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0003002494350 dbSNP139 T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0064004395260 TM5 T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0019003389898 FAMBGSD00001 T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0063004281815 TM4 T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0039003686328 KM4 T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0004003644650 Basenji T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0049004397387 LJ4 Y TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0076004483438 YJ7 Y TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0030003388806 GS6 T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0001001924501 solidGW1 T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-08-01 2014-08-01
snp_cf0012004350923 DQ4 T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0022003870348 FAMICHN00002 T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0018003626650 FAMBBEM00001 Y TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0050004055076 LJ5 T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0023004181600 FAMICHN00003 T TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0045003997412 LJ10 Y TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
snp_cf0078004445044 YJ9 Y TCTTTTCTCACACTTGGGAGTCATGGGCCA GGGAATGTGTTGAAGTTCATTTTAACTTGA 2014-07-19 2014-07-19
6.Fasta Information
GCATGAGGGC TGAAGGGGAC TCTTTTCTCA CACTTGGGAG TCATGGGCCA
T
GGGAATGTGT TGAAGTTCAT TTTAACTTGA AACATGATGG TATTTGCATA