e.g. 1:1246..9423
SNP Detail For snp_cf0038000895400    [See in GBrowse]
1.General Information
SNP ID: snp_cf0038000895400
Organism: Canis familiaris
Individual: KM3
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs22529507  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: R
5'flank: GGTCTGAATGTGGTAAAAGGTAGCTCAGGA
3'flank: ATGGAGAGCTGGTATTCTTTGAAGGCTTGG
3.Reference Map information
Chrom Position Reference KM3
Chr17 452161 G R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000003206 726 - G CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000005150 680 TCT => TTT ENSCAFP00000034098 227 S => F
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0012001176380 DQ4 A GGTCTGAATGTGGTAAAAGGTAGCTCAGGA ATGGAGAGCTGGTATTCTTTGAAGGCTTGG 2014-07-19 2014-07-19
snp_cf0009001176268 DQ1 R GGTCTGAATGTGGTAAAAGGTAGCTCAGGA ATGGAGAGCTGGTATTCTTTGAAGGCTTGG 2014-07-19 2014-07-19
snp_cf0042001217747 KM7 R GGTCTGAATGTGGTAAAAGGTAGCTCAGGA ATGGAGAGCTGGTATTCTTTGAAGGCTTGG 2014-07-19 2014-07-19
snp_cf0056001488145 LUPWRUS00001 A GGTCTGAATGTGGTAAAAGGTAGCTCAGGA ATGGAGAGCTGGTATTCTTTGAAGGCTTGG 2014-07-19 2014-07-19
snp_cf0064001182425 TM5 R GGTCTGAATGTGGTAAAAGGTAGCTCAGGA ATGGAGAGCTGGTATTCTTTGAAGGCTTGG 2014-07-19 2014-07-19
snp_cf0041001175475 KM6 R GGTCTGAATGTGGTAAAAGGTAGCTCAGGA ATGGAGAGCTGGTATTCTTTGAAGGCTTGG 2014-07-19 2014-07-19
snp_cf0046001084084 LJ1 R GGTCTGAATGTGGTAAAAGGTAGCTCAGGA ATGGAGAGCTGGTATTCTTTGAAGGCTTGG 2014-07-19 2014-07-19
snp_cf0020001160217 FAMBTIM00001 R GGTCTGAATGTGGTAAAAGGTAGCTCAGGA ATGGAGAGCTGGTATTCTTTGAAGGCTTGG 2014-07-19 2014-07-19
snp_cf0001000497889 solidGW1 A GGTCTGAATGTGGTAAAAGGTAGCTCAGGA ATGGAGAGCTGGTATTCTTTGAAGGCTTGG 2014-08-01 2014-08-01
snp_cf0004000976955 Basenji A GGTCTGAATGTGGTAAAAGGTAGCTCAGGA ATGGAGAGCTGGTATTCTTTGAAGGCTTGG 2014-07-19 2014-07-19
snp_cf0014001158163 DQ6 R GGTCTGAATGTGGTAAAAGGTAGCTCAGGA ATGGAGAGCTGGTATTCTTTGAAGGCTTGG 2014-07-19 2014-07-19
snp_cf0055001472220 LUPWCHN00001 A GGTCTGAATGTGGTAAAAGGTAGCTCAGGA ATGGAGAGCTGGTATTCTTTGAAGGCTTGG 2014-07-19 2014-07-19
snp_cf0007001001674 Dingo A GGTCTGAATGTGGTAAAAGGTAGCTCAGGA ATGGAGAGCTGGTATTCTTTGAAGGCTTGG 2014-07-19 2014-07-19
snp_cf0059001181768 TM10 A GGTCTGAATGTGGTAAAAGGTAGCTCAGGA ATGGAGAGCTGGTATTCTTTGAAGGCTTGG 2014-07-19 2014-07-19
snp_cf0073001162170 YJ4 R GGTCTGAATGTGGTAAAAGGTAGCTCAGGA ATGGAGAGCTGGTATTCTTTGAAGGCTTGG 2014-07-19 2014-07-19
snp_cf0076001210558 YJ7 A GGTCTGAATGTGGTAAAAGGTAGCTCAGGA ATGGAGAGCTGGTATTCTTTGAAGGCTTGG 2014-07-19 2014-07-19
snp_cf0047001129924 LJ2 R GGTCTGAATGTGGTAAAAGGTAGCTCAGGA ATGGAGAGCTGGTATTCTTTGAAGGCTTGG 2014-07-19 2014-07-19
snp_cf0049001183654 LJ4 R GGTCTGAATGTGGTAAAAGGTAGCTCAGGA ATGGAGAGCTGGTATTCTTTGAAGGCTTGG 2014-07-19 2014-07-19
snp_cf0023001086529 FAMICHN00003 R GGTCTGAATGTGGTAAAAGGTAGCTCAGGA ATGGAGAGCTGGTATTCTTTGAAGGCTTGG 2014-07-19 2014-07-19
snp_cf0069001210287 YJ10 R GGTCTGAATGTGGTAAAAGGTAGCTCAGGA ATGGAGAGCTGGTATTCTTTGAAGGCTTGG 2014-07-19 2014-07-19
snp_cf0010001157911 DQ2 R GGTCTGAATGTGGTAAAAGGTAGCTCAGGA ATGGAGAGCTGGTATTCTTTGAAGGCTTGG 2014-07-19 2014-07-19
snp_cf0065001145500 TM6 R GGTCTGAATGTGGTAAAAGGTAGCTCAGGA ATGGAGAGCTGGTATTCTTTGAAGGCTTGG 2014-07-19 2014-07-19
snp_cf0058001473302 LUPWRUS00003 A GGTCTGAATGTGGTAAAAGGTAGCTCAGGA ATGGAGAGCTGGTATTCTTTGAAGGCTTGG 2014-07-19 2014-07-19
snp_cf0051001176464 LJ6 R GGTCTGAATGTGGTAAAAGGTAGCTCAGGA ATGGAGAGCTGGTATTCTTTGAAGGCTTGG 2014-07-19 2014-07-19
snp_cf0078001198906 YJ9 A GGTCTGAATGTGGTAAAAGGTAGCTCAGGA ATGGAGAGCTGGTATTCTTTGAAGGCTTGG 2014-07-19 2014-07-19
snp_cf0002000766628 CID1 A GGTCTGAATGTGGTAAAAGGTAGCTCAGGA ATGGAGAGCTGGTATTCTTTGAAGGCTTGG 2014-08-02 2014-08-02
snp_cf0074001192890 YJ5 A GGTCTGAATGTGGTAAAAGGTAGCTCAGGA ATGGAGAGCTGGTATTCTTTGAAGGCTTGG 2014-07-19 2014-07-19
snp_cf0021001115596 FAMICHN00001 A GGTCTGAATGTGGTAAAAGGTAGCTCAGGA ATGGAGAGCTGGTATTCTTTGAAGGCTTGG 2014-07-19 2014-07-19
snp_cf0057001409048 LUPWRUS00002 A GGTCTGAATGTGGTAAAAGGTAGCTCAGGA ATGGAGAGCTGGTATTCTTTGAAGGCTTGG 2014-07-19 2014-07-19
snp_cf0054001043139 LJ9 R GGTCTGAATGTGGTAAAAGGTAGCTCAGGA ATGGAGAGCTGGTATTCTTTGAAGGCTTGG 2014-07-19 2014-07-19
snp_cf0050001086447 LJ5 R GGTCTGAATGTGGTAAAAGGTAGCTCAGGA ATGGAGAGCTGGTATTCTTTGAAGGCTTGG 2014-07-19 2014-07-19
snp_cf0068001121955 TM9 A GGTCTGAATGTGGTAAAAGGTAGCTCAGGA ATGGAGAGCTGGTATTCTTTGAAGGCTTGG 2014-07-19 2014-07-19
snp_cf0067001143006 TM8 A GGTCTGAATGTGGTAAAAGGTAGCTCAGGA ATGGAGAGCTGGTATTCTTTGAAGGCTTGG 2014-07-19 2014-07-19
snp_cf0061001189007 TM2 A GGTCTGAATGTGGTAAAAGGTAGCTCAGGA ATGGAGAGCTGGTATTCTTTGAAGGCTTGG 2014-07-19 2014-07-19
snp_cf0016001169525 DQ8 A GGTCTGAATGTGGTAAAAGGTAGCTCAGGA ATGGAGAGCTGGTATTCTTTGAAGGCTTGG 2014-07-19 2014-07-19
snp_cf0063001151703 TM4 R GGTCTGAATGTGGTAAAAGGTAGCTCAGGA ATGGAGAGCTGGTATTCTTTGAAGGCTTGG 2014-07-19 2014-07-19
snp_cf0066001199713 TM7 R GGTCTGAATGTGGTAAAAGGTAGCTCAGGA ATGGAGAGCTGGTATTCTTTGAAGGCTTGG 2014-07-19 2014-07-19
snp_cf0011001190848 DQ3 R GGTCTGAATGTGGTAAAAGGTAGCTCAGGA ATGGAGAGCTGGTATTCTTTGAAGGCTTGG 2014-07-19 2014-07-19
snp_cf0075001204021 YJ6 R GGTCTGAATGTGGTAAAAGGTAGCTCAGGA ATGGAGAGCTGGTATTCTTTGAAGGCTTGG 2014-07-19 2014-07-19
snp_cf0060001167128 TM1 R GGTCTGAATGTGGTAAAAGGTAGCTCAGGA ATGGAGAGCTGGTATTCTTTGAAGGCTTGG 2014-07-19 2014-07-19
snp_cf0070001241296 YJ1 A GGTCTGAATGTGGTAAAAGGTAGCTCAGGA ATGGAGAGCTGGTATTCTTTGAAGGCTTGG 2014-07-19 2014-07-19
snp_cf0003000659166 dbSNP139 A GGTCTGAATGTGGTAAAAGGTAGCTCAGGA ATGGAGAGCTGGTATTCTTTGAAGGCTTGG 2014-07-19 2014-07-19
snp_cf0062001177793 TM3 R GGTCTGAATGTGGTAAAAGGTAGCTCAGGA ATGGAGAGCTGGTATTCTTTGAAGGCTTGG 2014-07-19 2014-07-19
snp_cf0072001205709 YJ3 A GGTCTGAATGTGGTAAAAGGTAGCTCAGGA ATGGAGAGCTGGTATTCTTTGAAGGCTTGG 2014-07-19 2014-07-19
snp_cf0034001383549 ISW A GGTCTGAATGTGGTAAAAGGTAGCTCAGGA ATGGAGAGCTGGTATTCTTTGAAGGCTTGG 2014-07-19 2014-07-19
6.Fasta Information
TGGCATTCTG GGGCTTTTTG GGTCTGAATG TGGTAAAAGG TAGCTCAGGA
R
ATGGAGAGCT GGTATTCTTT GAAGGCTTGG CCAAGCCCAA GAAGGCTAAG