e.g. 1:1246..9423
SNP Detail For snp_cf0038000895401    [See in GBrowse]
1.General Information
SNP ID: snp_cf0038000895401
Organism: Canis familiaris
Individual: KM3
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: S
5'flank: GTGGCAGATCTGGCACCTCTATTCCCGGCA
3'flank: CAGCACCACTCCTCTGGTGGCACACCAGTC
3.Reference Map information
Chrom Position Reference KM3
Chr17 452403 G S
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000003206 484 - G CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000005150 478 CTG => GTG ENSCAFP00000034098 160 L => V
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0012001176381 DQ4 C GTGGCAGATCTGGCACCTCTATTCCCGGCA CAGCACCACTCCTCTGGTGGCACACCAGTC 2014-07-19 2014-07-19
snp_cf0042001217748 KM7 S GTGGCAGATCTGGCACCTCTATTCCCGGCA CAGCACCACTCCTCTGGTGGCACACCAGTC 2014-07-19 2014-07-19
snp_cf0072001205710 YJ3 C GTGGCAGATCTGGCACCTCTATTCCCGGCA CAGCACCACTCCTCTGGTGGCACACCAGTC 2014-07-19 2014-07-19
snp_cf0064001182426 TM5 S GTGGCAGATCTGGCACCTCTATTCCCGGCA CAGCACCACTCCTCTGGTGGCACACCAGTC 2014-07-19 2014-07-19
snp_cf0056001488146 LUPWRUS00001 C GTGGCAGATCTGGCACCTCTATTCCCGGCA CAGCACCACTCCTCTGGTGGCACACCAGTC 2014-07-19 2014-07-19
snp_cf0054001043140 LJ9 S GTGGCAGATCTGGCACCTCTATTCCCGGCA CAGCACCACTCCTCTGGTGGCACACCAGTC 2014-07-19 2014-07-19
snp_cf0041001175476 KM6 S GTGGCAGATCTGGCACCTCTATTCCCGGCA CAGCACCACTCCTCTGGTGGCACACCAGTC 2014-07-19 2014-07-19
snp_cf0075001204022 YJ6 S GTGGCAGATCTGGCACCTCTATTCCCGGCA CAGCACCACTCCTCTGGTGGCACACCAGTC 2014-07-19 2014-07-19
snp_cf0046001084085 LJ1 S GTGGCAGATCTGGCACCTCTATTCCCGGCA CAGCACCACTCCTCTGGTGGCACACCAGTC 2014-07-19 2014-07-19
snp_cf0014001158164 DQ6 S GTGGCAGATCTGGCACCTCTATTCCCGGCA CAGCACCACTCCTCTGGTGGCACACCAGTC 2014-07-19 2014-07-19
snp_cf0020001160218 FAMBTIM00001 S GTGGCAGATCTGGCACCTCTATTCCCGGCA CAGCACCACTCCTCTGGTGGCACACCAGTC 2014-07-19 2014-07-19
snp_cf0004000976956 Basenji C GTGGCAGATCTGGCACCTCTATTCCCGGCA CAGCACCACTCCTCTGGTGGCACACCAGTC 2014-07-19 2014-07-19
snp_cf0055001472221 LUPWCHN00001 C GTGGCAGATCTGGCACCTCTATTCCCGGCA CAGCACCACTCCTCTGGTGGCACACCAGTC 2014-07-19 2014-07-19
snp_cf0059001181769 TM10 C GTGGCAGATCTGGCACCTCTATTCCCGGCA CAGCACCACTCCTCTGGTGGCACACCAGTC 2014-07-19 2014-07-19
snp_cf0073001162171 YJ4 S GTGGCAGATCTGGCACCTCTATTCCCGGCA CAGCACCACTCCTCTGGTGGCACACCAGTC 2014-07-19 2014-07-19
snp_cf0047001129925 LJ2 S GTGGCAGATCTGGCACCTCTATTCCCGGCA CAGCACCACTCCTCTGGTGGCACACCAGTC 2014-07-19 2014-07-19
snp_cf0049001183655 LJ4 S GTGGCAGATCTGGCACCTCTATTCCCGGCA CAGCACCACTCCTCTGGTGGCACACCAGTC 2014-07-19 2014-07-19
snp_cf0076001210559 YJ7 C GTGGCAGATCTGGCACCTCTATTCCCGGCA CAGCACCACTCCTCTGGTGGCACACCAGTC 2014-07-19 2014-07-19
snp_cf0034001383550 ISW C GTGGCAGATCTGGCACCTCTATTCCCGGCA CAGCACCACTCCTCTGGTGGCACACCAGTC 2014-07-19 2014-07-19
snp_cf0069001210288 YJ10 S GTGGCAGATCTGGCACCTCTATTCCCGGCA CAGCACCACTCCTCTGGTGGCACACCAGTC 2014-07-19 2014-07-19
snp_cf0001000497890 solidGW1 C GTGGCAGATCTGGCACCTCTATTCCCGGCA CAGCACCACTCCTCTGGTGGCACACCAGTC 2014-08-01 2014-08-01
snp_cf0010001157912 DQ2 S GTGGCAGATCTGGCACCTCTATTCCCGGCA CAGCACCACTCCTCTGGTGGCACACCAGTC 2014-07-19 2014-07-19
snp_cf0058001473303 LUPWRUS00003 C GTGGCAGATCTGGCACCTCTATTCCCGGCA CAGCACCACTCCTCTGGTGGCACACCAGTC 2014-07-19 2014-07-19
snp_cf0023001086530 FAMICHN00003 S GTGGCAGATCTGGCACCTCTATTCCCGGCA CAGCACCACTCCTCTGGTGGCACACCAGTC 2014-07-19 2014-07-19
snp_cf0065001145501 TM6 S GTGGCAGATCTGGCACCTCTATTCCCGGCA CAGCACCACTCCTCTGGTGGCACACCAGTC 2014-07-19 2014-07-19
snp_cf0051001176465 LJ6 S GTGGCAGATCTGGCACCTCTATTCCCGGCA CAGCACCACTCCTCTGGTGGCACACCAGTC 2014-07-19 2014-07-19
snp_cf0078001198907 YJ9 C GTGGCAGATCTGGCACCTCTATTCCCGGCA CAGCACCACTCCTCTGGTGGCACACCAGTC 2014-07-19 2014-07-19
snp_cf0057001409049 LUPWRUS00002 C GTGGCAGATCTGGCACCTCTATTCCCGGCA CAGCACCACTCCTCTGGTGGCACACCAGTC 2014-07-19 2014-07-19
snp_cf0060001167129 TM1 S GTGGCAGATCTGGCACCTCTATTCCCGGCA CAGCACCACTCCTCTGGTGGCACACCAGTC 2014-07-19 2014-07-19
snp_cf0002000766629 CID1 C GTGGCAGATCTGGCACCTCTATTCCCGGCA CAGCACCACTCCTCTGGTGGCACACCAGTC 2014-08-02 2014-08-02
snp_cf0074001192891 YJ5 C GTGGCAGATCTGGCACCTCTATTCCCGGCA CAGCACCACTCCTCTGGTGGCACACCAGTC 2014-07-19 2014-07-19
snp_cf0021001115597 FAMICHN00001 C GTGGCAGATCTGGCACCTCTATTCCCGGCA CAGCACCACTCCTCTGGTGGCACACCAGTC 2014-07-19 2014-07-19
snp_cf0068001121956 TM9 C GTGGCAGATCTGGCACCTCTATTCCCGGCA CAGCACCACTCCTCTGGTGGCACACCAGTC 2014-07-19 2014-07-19
snp_cf0050001086448 LJ5 S GTGGCAGATCTGGCACCTCTATTCCCGGCA CAGCACCACTCCTCTGGTGGCACACCAGTC 2014-07-19 2014-07-19
snp_cf0007001001675 Dingo C GTGGCAGATCTGGCACCTCTATTCCCGGCA CAGCACCACTCCTCTGGTGGCACACCAGTC 2014-07-19 2014-07-19
snp_cf0061001189008 TM2 C GTGGCAGATCTGGCACCTCTATTCCCGGCA CAGCACCACTCCTCTGGTGGCACACCAGTC 2014-07-19 2014-07-19
snp_cf0016001169526 DQ8 C GTGGCAGATCTGGCACCTCTATTCCCGGCA CAGCACCACTCCTCTGGTGGCACACCAGTC 2014-07-19 2014-07-19
snp_cf0067001143007 TM8 C GTGGCAGATCTGGCACCTCTATTCCCGGCA CAGCACCACTCCTCTGGTGGCACACCAGTC 2014-07-19 2014-07-19
snp_cf0063001151704 TM4 S GTGGCAGATCTGGCACCTCTATTCCCGGCA CAGCACCACTCCTCTGGTGGCACACCAGTC 2014-07-19 2014-07-19
snp_cf0066001199714 TM7 S GTGGCAGATCTGGCACCTCTATTCCCGGCA CAGCACCACTCCTCTGGTGGCACACCAGTC 2014-07-19 2014-07-19
snp_cf0011001190849 DQ3 S GTGGCAGATCTGGCACCTCTATTCCCGGCA CAGCACCACTCCTCTGGTGGCACACCAGTC 2014-07-19 2014-07-19
snp_cf0070001241297 YJ1 C GTGGCAGATCTGGCACCTCTATTCCCGGCA CAGCACCACTCCTCTGGTGGCACACCAGTC 2014-07-19 2014-07-19
snp_cf0009001176269 DQ1 S GTGGCAGATCTGGCACCTCTATTCCCGGCA CAGCACCACTCCTCTGGTGGCACACCAGTC 2014-07-19 2014-07-19
snp_cf0062001177794 TM3 S GTGGCAGATCTGGCACCTCTATTCCCGGCA CAGCACCACTCCTCTGGTGGCACACCAGTC 2014-07-19 2014-07-19
6.Fasta Information
ACAGTCCAGG GGCTTCGTGG GTGGCAGATC TGGCACCTCT ATTCCCGGCA
S
CAGCACCACT CCTCTGGTGG CACACCAGTC CCCATATCTG GGGTGTATGC