e.g. 1:1246..9423
SNP Detail For snp_cf0038000895404    [See in GBrowse]
1.General Information
SNP ID: snp_cf0038000895404
Organism: Canis familiaris
Individual: KM3
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: R
5'flank: TGGTCCACGGGTCAGTCAGTTGTCGGAGGT
3'flank: GCAGCTCTGAAGGAAGGGTGTGAAGGCTCG
3.Reference Map information
Chrom Position Reference KM3
Chr17 452676 G R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000003206 211 - G CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000005150 211 CAC => TAC ENSCAFP00000034098 71 H => Y
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0054001043142 LJ9 A TGGTCCACGGGTCAGTCAGTTGTCGGAGGT GCAGCTCTGAAGGAAGGGTGTGAAGGCTCG 2014-07-19 2014-07-19
snp_cf0056001488149 LUPWRUS00001 A TGGTCCACGGGTCAGTCAGTTGTCGGAGGT GCAGCTCTGAAGGAAGGGTGTGAAGGCTCG 2014-07-19 2014-07-19
snp_cf0021001115600 FAMICHN00001 A TGGTCCACGGGTCAGTCAGTTGTCGGAGGT GCAGCTCTGAAGGAAGGGTGTGAAGGCTCG 2014-07-19 2014-07-19
snp_cf0064001182429 TM5 R TGGTCCACGGGTCAGTCAGTTGTCGGAGGT GCAGCTCTGAAGGAAGGGTGTGAAGGCTCG 2014-07-19 2014-07-19
snp_cf0055001472224 LUPWCHN00001 A TGGTCCACGGGTCAGTCAGTTGTCGGAGGT GCAGCTCTGAAGGAAGGGTGTGAAGGCTCG 2014-07-19 2014-07-19
snp_cf0072001205713 YJ3 A TGGTCCACGGGTCAGTCAGTTGTCGGAGGT GCAGCTCTGAAGGAAGGGTGTGAAGGCTCG 2014-07-19 2014-07-19
snp_cf0004000976959 Basenji A TGGTCCACGGGTCAGTCAGTTGTCGGAGGT GCAGCTCTGAAGGAAGGGTGTGAAGGCTCG 2014-07-19 2014-07-19
snp_cf0014001158167 DQ6 R TGGTCCACGGGTCAGTCAGTTGTCGGAGGT GCAGCTCTGAAGGAAGGGTGTGAAGGCTCG 2014-07-19 2014-07-19
snp_cf0075001204025 YJ6 R TGGTCCACGGGTCAGTCAGTTGTCGGAGGT GCAGCTCTGAAGGAAGGGTGTGAAGGCTCG 2014-07-19 2014-07-19
snp_cf0057001409052 LUPWRUS00002 A TGGTCCACGGGTCAGTCAGTTGTCGGAGGT GCAGCTCTGAAGGAAGGGTGTGAAGGCTCG 2014-07-19 2014-07-19
snp_cf0041001175479 KM6 R TGGTCCACGGGTCAGTCAGTTGTCGGAGGT GCAGCTCTGAAGGAAGGGTGTGAAGGCTCG 2014-07-19 2014-07-19
snp_cf0046001084088 LJ1 A TGGTCCACGGGTCAGTCAGTTGTCGGAGGT GCAGCTCTGAAGGAAGGGTGTGAAGGCTCG 2014-07-19 2014-07-19
snp_cf0069001210292 YJ10 R TGGTCCACGGGTCAGTCAGTTGTCGGAGGT GCAGCTCTGAAGGAAGGGTGTGAAGGCTCG 2014-07-19 2014-07-19
snp_cf0050001086450 LJ5 R TGGTCCACGGGTCAGTCAGTTGTCGGAGGT GCAGCTCTGAAGGAAGGGTGTGAAGGCTCG 2014-07-19 2014-07-19
snp_cf0049001183658 LJ4 R TGGTCCACGGGTCAGTCAGTTGTCGGAGGT GCAGCTCTGAAGGAAGGGTGTGAAGGCTCG 2014-07-19 2014-07-19
snp_cf0034001383553 ISW A TGGTCCACGGGTCAGTCAGTTGTCGGAGGT GCAGCTCTGAAGGAAGGGTGTGAAGGCTCG 2014-07-19 2014-07-19
snp_cf0061001189011 TM2 A TGGTCCACGGGTCAGTCAGTTGTCGGAGGT GCAGCTCTGAAGGAAGGGTGTGAAGGCTCG 2014-07-19 2014-07-19
snp_cf0067001143010 TM8 A TGGTCCACGGGTCAGTCAGTTGTCGGAGGT GCAGCTCTGAAGGAAGGGTGTGAAGGCTCG 2014-07-19 2014-07-19
snp_cf0078001198910 YJ9 A TGGTCCACGGGTCAGTCAGTTGTCGGAGGT GCAGCTCTGAAGGAAGGGTGTGAAGGCTCG 2014-07-19 2014-07-19
snp_cf0060001167132 TM1 R TGGTCCACGGGTCAGTCAGTTGTCGGAGGT GCAGCTCTGAAGGAAGGGTGTGAAGGCTCG 2014-07-19 2014-07-19
snp_cf0073001162174 YJ4 R TGGTCCACGGGTCAGTCAGTTGTCGGAGGT GCAGCTCTGAAGGAAGGGTGTGAAGGCTCG 2014-07-19 2014-07-19
snp_cf0010001157915 DQ2 R TGGTCCACGGGTCAGTCAGTTGTCGGAGGT GCAGCTCTGAAGGAAGGGTGTGAAGGCTCG 2014-07-19 2014-07-19
snp_cf0070001241300 YJ1 A TGGTCCACGGGTCAGTCAGTTGTCGGAGGT GCAGCTCTGAAGGAAGGGTGTGAAGGCTCG 2014-07-19 2014-07-19
snp_cf0011001190852 DQ3 R TGGTCCACGGGTCAGTCAGTTGTCGGAGGT GCAGCTCTGAAGGAAGGGTGTGAAGGCTCG 2014-07-19 2014-07-19
snp_cf0047001129928 LJ2 R TGGTCCACGGGTCAGTCAGTTGTCGGAGGT GCAGCTCTGAAGGAAGGGTGTGAAGGCTCG 2014-07-19 2014-07-19
snp_cf0065001145504 TM6 A TGGTCCACGGGTCAGTCAGTTGTCGGAGGT GCAGCTCTGAAGGAAGGGTGTGAAGGCTCG 2014-07-19 2014-07-19
snp_cf0009001176272 DQ1 R TGGTCCACGGGTCAGTCAGTTGTCGGAGGT GCAGCTCTGAAGGAAGGGTGTGAAGGCTCG 2014-07-19 2014-07-19
snp_cf0001000497894 solidGW1 A TGGTCCACGGGTCAGTCAGTTGTCGGAGGT GCAGCTCTGAAGGAAGGGTGTGAAGGCTCG 2014-08-01 2014-08-01
snp_cf0051001176468 LJ6 R TGGTCCACGGGTCAGTCAGTTGTCGGAGGT GCAGCTCTGAAGGAAGGGTGTGAAGGCTCG 2014-07-19 2014-07-19
snp_cf0066001199717 TM7 R TGGTCCACGGGTCAGTCAGTTGTCGGAGGT GCAGCTCTGAAGGAAGGGTGTGAAGGCTCG 2014-07-19 2014-07-19
snp_cf0068001121959 TM9 A TGGTCCACGGGTCAGTCAGTTGTCGGAGGT GCAGCTCTGAAGGAAGGGTGTGAAGGCTCG 2014-07-19 2014-07-19
snp_cf0042001217751 KM7 R TGGTCCACGGGTCAGTCAGTTGTCGGAGGT GCAGCTCTGAAGGAAGGGTGTGAAGGCTCG 2014-07-19 2014-07-19
snp_cf0023001086533 FAMICHN00003 R TGGTCCACGGGTCAGTCAGTTGTCGGAGGT GCAGCTCTGAAGGAAGGGTGTGAAGGCTCG 2014-07-19 2014-07-19
snp_cf0007001001678 Dingo A TGGTCCACGGGTCAGTCAGTTGTCGGAGGT GCAGCTCTGAAGGAAGGGTGTGAAGGCTCG 2014-07-19 2014-07-19
snp_cf0058001473306 LUPWRUS00003 A TGGTCCACGGGTCAGTCAGTTGTCGGAGGT GCAGCTCTGAAGGAAGGGTGTGAAGGCTCG 2014-07-19 2014-07-19
snp_cf0016001169529 DQ8 A TGGTCCACGGGTCAGTCAGTTGTCGGAGGT GCAGCTCTGAAGGAAGGGTGTGAAGGCTCG 2014-07-19 2014-07-19
snp_cf0020001160220 FAMBTIM00001 R TGGTCCACGGGTCAGTCAGTTGTCGGAGGT GCAGCTCTGAAGGAAGGGTGTGAAGGCTCG 2014-07-19 2014-07-19
snp_cf0059001181772 TM10 A TGGTCCACGGGTCAGTCAGTTGTCGGAGGT GCAGCTCTGAAGGAAGGGTGTGAAGGCTCG 2014-07-19 2014-07-19
snp_cf0074001192894 YJ5 A TGGTCCACGGGTCAGTCAGTTGTCGGAGGT GCAGCTCTGAAGGAAGGGTGTGAAGGCTCG 2014-07-19 2014-07-19
snp_cf0063001151707 TM4 R TGGTCCACGGGTCAGTCAGTTGTCGGAGGT GCAGCTCTGAAGGAAGGGTGTGAAGGCTCG 2014-07-19 2014-07-19
snp_cf0062001177797 TM3 R TGGTCCACGGGTCAGTCAGTTGTCGGAGGT GCAGCTCTGAAGGAAGGGTGTGAAGGCTCG 2014-07-19 2014-07-19
snp_cf0076001210562 YJ7 A TGGTCCACGGGTCAGTCAGTTGTCGGAGGT GCAGCTCTGAAGGAAGGGTGTGAAGGCTCG 2014-07-19 2014-07-19
snp_cf0012001176384 DQ4 A TGGTCCACGGGTCAGTCAGTTGTCGGAGGT GCAGCTCTGAAGGAAGGGTGTGAAGGCTCG 2014-07-19 2014-07-19
6.Fasta Information
CCAGGTGGTA GGCCACGCAC TGGTCCACGG GTCAGTCAGT TGTCGGAGGT
R
GCAGCTCTGA AGGAAGGGTG TGAAGGCTCG GTCAAACGTG GCAGGTGTGC